Incidental Mutation 'R0265:P4ha1'
ID34864
Institutional Source Beutler Lab
Gene Symbol P4ha1
Ensembl Gene ENSMUSG00000019916
Gene Nameprocollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide
SynonymsP4ha
MMRRC Submission 038491-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0265 (G1)
Quality Score162
Status Validated
Chromosome10
Chromosomal Location59323296-59373304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59348259 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 181 (Y181C)
Ref Sequence ENSEMBL: ENSMUSP00000101106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009789] [ENSMUST00000092512] [ENSMUST00000105466]
Predicted Effect probably damaging
Transcript: ENSMUST00000009789
AA Change: Y181C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009789
Gene: ENSMUSG00000019916
AA Change: Y181C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:P4Ha_N 23 156 2e-47 PFAM
low complexity region 220 235 N/A INTRINSIC
P4Hc 335 518 2.2e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092512
SMART Domains Protein: ENSMUSP00000090170
Gene: ENSMUSG00000019916

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:P4Ha_N 23 156 7.4e-48 PFAM
P4Hc 255 438 1.2e-75 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105466
AA Change: Y181C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101106
Gene: ENSMUSG00000019916
AA Change: Y181C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:P4Ha_N 24 155 2.1e-42 PFAM
low complexity region 220 235 N/A INTRINSIC
P4Hc 335 518 1.2e-75 SMART
Meta Mutation Damage Score 0.8566 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.6%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, capillary ruptures, and impaired basement membrane formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T G 14: 8,431,667 Y655S probably damaging Het
9330182L06Rik T C 5: 9,434,681 L486P probably damaging Het
Abca14 A G 7: 120,223,627 I321V probably benign Het
Adcy7 A G 8: 88,324,763 D837G probably damaging Het
Aldh1a1 T A 19: 20,640,076 Y457* probably null Het
Alox5 T C 6: 116,420,362 Y287C probably benign Het
Ano8 T C 8: 71,480,524 probably benign Het
Ap3b1 A G 13: 94,493,681 K815E unknown Het
Atp11a A T 8: 12,856,930 probably benign Het
Atp6v0a1 A T 11: 101,048,515 D702V possibly damaging Het
Cacna1b T A 2: 24,761,844 N108Y probably damaging Het
Ccdc57 G C 11: 120,921,811 A39G probably benign Het
Cdhr1 A T 14: 37,081,376 V581D probably benign Het
Cyp2b23 A G 7: 26,672,879 probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Ddit4l C T 3: 137,624,287 probably benign Het
Dnah8 A T 17: 30,690,271 I1024F probably benign Het
Edc3 T A 9: 57,727,338 F213I probably damaging Het
Edrf1 G A 7: 133,657,045 D717N probably damaging Het
Efna5 G A 17: 62,651,073 P63S probably damaging Het
Entpd3 A G 9: 120,558,481 Y248C probably damaging Het
Flcn G A 11: 59,795,809 Q373* probably null Het
Fry T C 5: 150,434,776 V1908A probably damaging Het
Gabrg3 A T 7: 57,381,617 Y58* probably null Het
Gabrp A T 11: 33,552,614 Y417N probably damaging Het
Golga2 C A 2: 32,304,952 probably null Het
Grip2 C A 6: 91,773,792 probably null Het
Gsx2 A G 5: 75,077,068 Y227C probably damaging Het
Hif3a T C 7: 17,035,868 *665W probably null Het
Hist1h2aa T C 13: 23,934,649 V63A probably benign Het
Hsd3b1 C A 3: 98,852,773 V301L probably damaging Het
Ifitm5 T C 7: 140,950,008 probably benign Het
Inpp4a A T 1: 37,378,986 D498V probably damaging Het
Itga1 A T 13: 114,992,459 D554E probably benign Het
Itk G A 11: 46,389,458 probably benign Het
Kdm3b T A 18: 34,795,663 probably benign Het
Klhl6 A G 16: 19,948,234 V470A probably benign Het
Lamb3 T A 1: 193,320,531 W95R probably damaging Het
Lbhd2 T A 12: 111,410,242 I41N probably damaging Het
Lrp4 A T 2: 91,490,670 S1014C probably damaging Het
Ltbp2 C T 12: 84,785,969 probably null Het
Map3k19 A G 1: 127,822,182 I1144T possibly damaging Het
Mfsd10 T C 5: 34,635,163 probably benign Het
Mocos A G 18: 24,666,276 D189G probably benign Het
Mvb12a T A 8: 71,547,010 F224L probably damaging Het
Myo15 A T 11: 60,514,897 probably null Het
Nos2 A T 11: 78,937,602 H249L probably damaging Het
Notum A G 11: 120,658,334 M184T probably benign Het
Nvl C A 1: 181,134,830 D192Y probably damaging Het
Olfr1024 T A 2: 85,904,247 N269I probably benign Het
Olfr1065 C A 2: 86,445,959 V8L probably benign Het
Olfr1308 T C 2: 111,960,494 Y193C probably damaging Het
Olfr204 A T 16: 59,315,071 F112Y probably damaging Het
Olfr218 A G 1: 173,203,917 K187R probably benign Het
Osgin1 A G 8: 119,445,657 I397V possibly damaging Het
Otulin A G 15: 27,616,424 V123A probably damaging Het
Pcdhgc5 A T 18: 37,821,350 D559V probably damaging Het
Phf2 T C 13: 48,828,794 N151S unknown Het
Plxnc1 C A 10: 94,813,129 G1263C probably benign Het
Rad51ap1 A G 6: 126,924,197 *338Q probably null Het
Raver1 A G 9: 21,075,659 S676P probably benign Het
Rfx8 T C 1: 39,688,577 E196G possibly damaging Het
Rreb1 A T 13: 37,916,155 K187* probably null Het
Rxfp1 T C 3: 79,667,654 T217A probably benign Het
Rxra T C 2: 27,752,430 L305P probably damaging Het
Sardh T C 2: 27,227,066 probably benign Het
Skor2 A T 18: 76,876,598 E952D probably damaging Het
Slc22a29 A T 19: 8,169,970 S343T probably benign Het
Sorbs2 T C 8: 45,785,337 probably benign Het
Supt7l C T 5: 31,515,918 V329I probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 T C 6: 7,559,165 probably benign Het
Tcn2 A T 11: 3,922,044 V361D probably damaging Het
Tm2d3 G A 7: 65,697,834 A170T possibly damaging Het
Tnks G A 8: 34,839,970 R1142* probably null Het
Ttll7 C A 3: 146,944,160 Y648* probably null Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Upf2 G A 2: 6,027,204 probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Washc5 A G 15: 59,338,960 I1013T probably benign Het
Wdr60 T C 12: 116,257,406 probably benign Het
Zfp704 C A 3: 9,565,157 R48L probably damaging Het
Other mutations in P4ha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:P4ha1 APN 10 59339335 missense probably damaging 1.00
IGL01820:P4ha1 APN 10 59361914 missense probably damaging 1.00
IGL02340:P4ha1 APN 10 59352201 missense probably benign 0.03
IGL02480:P4ha1 APN 10 59343752 missense probably damaging 1.00
IGL02496:P4ha1 APN 10 59371002 critical splice acceptor site probably null
PIT4453001:P4ha1 UTSW 10 59350472 missense probably benign
R0149:P4ha1 UTSW 10 59348399 missense probably damaging 1.00
R0282:P4ha1 UTSW 10 59337148 missense probably damaging 1.00
R0432:P4ha1 UTSW 10 59348257 nonsense probably null
R0683:P4ha1 UTSW 10 59337147 missense probably benign 0.05
R1929:P4ha1 UTSW 10 59371037 missense probably damaging 1.00
R5790:P4ha1 UTSW 10 59354362 missense probably benign 0.07
R5858:P4ha1 UTSW 10 59339378 missense probably damaging 1.00
R5955:P4ha1 UTSW 10 59342796 missense probably benign 0.00
R6123:P4ha1 UTSW 10 59350527 missense possibly damaging 0.80
R7237:P4ha1 UTSW 10 59348243 missense probably benign
R7350:P4ha1 UTSW 10 59350418 missense probably damaging 0.97
R7380:P4ha1 UTSW 10 59350451 missense probably benign 0.28
R7583:P4ha1 UTSW 10 59369640 missense probably benign 0.03
R8356:P4ha1 UTSW 10 59355363 missense probably damaging 1.00
R8843:P4ha1 UTSW 10 59369633 missense probably damaging 1.00
X0062:P4ha1 UTSW 10 59348246 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AATCTTGTGACTTCCTGCCGAGC -3'
(R):5'- AGTCAGGCCAGATAACAGACCTAGC -3'

Sequencing Primer
(F):5'- actgcctgcctttgcttc -3'
(R):5'- AGATAACAGACCTAGCTCAAGAAG -3'
Posted On2013-05-09