Incidental Mutation 'R4673:Adamdec1'
ID348643
Institutional Source Beutler Lab
Gene Symbol Adamdec1
Ensembl Gene ENSMUSG00000022057
Gene NameADAM-like, decysin 1
Synonyms2210414L24Rik, Dcsn
MMRRC Submission 041928-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4673 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location68563380-68582095 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 68577904 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 104 (E104*)
Ref Sequence ENSEMBL: ENSMUSP00000022641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022641]
Predicted Effect probably null
Transcript: ENSMUST00000022641
AA Change: E104*
SMART Domains Protein: ENSMUSP00000022641
Gene: ENSMUSG00000022057
AA Change: E104*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 37 175 3.9e-29 PFAM
Pfam:Reprolysin_5 215 389 9.8e-17 PFAM
Pfam:Reprolysin_4 216 407 7.3e-12 PFAM
Pfam:Reprolysin 217 411 1.5e-57 PFAM
Pfam:Reprolysin_3 242 360 1e-11 PFAM
DISIN 427 465 1.12e-3 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This encoded protein is thought to be a secreted protein belonging to the disintegrin metalloproteinase family. Its expression is upregulated during dendritic cells maturation. This protein may play an important role in dendritic cell function and their interactions with germinal center T cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,884,455 E507G probably damaging Het
Adam39 C T 8: 40,824,731 T53I probably benign Het
Adam4 A T 12: 81,421,761 S29T possibly damaging Het
Alas1 G T 9: 106,236,477 P523Q probably damaging Het
Aldh3a1 A G 11: 61,213,494 D69G probably benign Het
Arhgap29 T A 3: 122,014,971 V1266E probably damaging Het
Bcdin3d T C 15: 99,470,838 D160G probably damaging Het
Btaf1 T A 19: 36,978,372 F569I probably benign Het
Cacna1b A G 2: 24,631,944 L1718S probably damaging Het
Casd1 A G 6: 4,629,975 Y457C probably damaging Het
Creb3 T C 4: 43,563,192 V97A probably benign Het
Cux2 G T 5: 121,887,476 S43* probably null Het
Fam160a1 A T 3: 85,730,713 V93D probably damaging Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gm11565 A G 11: 99,915,214 D144G probably benign Het
Gm7534 G A 4: 134,200,347 A365V probably benign Het
Gpn3 A G 5: 122,373,918 Y19C probably damaging Het
Gstz1 A T 12: 87,162,063 T148S probably benign Het
Gtf3c5 A G 2: 28,572,224 I282T probably benign Het
Hspa2 T A 12: 76,405,740 S403T possibly damaging Het
Il27 G A 7: 126,591,079 T121I possibly damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kctd1 T A 18: 15,063,227 probably benign Het
Kynu A G 2: 43,679,803 T366A probably damaging Het
Lama5 G A 2: 180,199,266 T507I probably damaging Het
Myh11 C T 16: 14,269,241 V124M probably damaging Het
Myh14 T A 7: 44,624,330 H1331L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Myh4 T C 11: 67,246,401 F483L probably benign Het
Nbeal1 A C 1: 60,329,390 K2631N probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Ogg1 T C 6: 113,327,307 C28R probably damaging Het
Olfr1449 G A 19: 12,935,097 A120T probably damaging Het
Olfr157 T C 4: 43,836,430 H20R probably benign Het
Olfr181 C T 16: 58,925,690 V294I possibly damaging Het
Olfr49 C T 14: 54,282,332 A188T possibly damaging Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phf14 A G 6: 11,992,057 H744R probably damaging Het
Pibf1 A G 14: 99,133,351 N263S possibly damaging Het
Plcb4 A G 2: 135,932,271 T158A possibly damaging Het
Plce1 T C 19: 38,749,396 S1615P possibly damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rgs22 T A 15: 36,099,933 Y212F probably benign Het
Rnd3 G A 2: 51,132,541 A163V probably benign Het
Rnf10 A T 5: 115,251,089 V315E probably damaging Het
Robo2 C T 16: 73,904,378 probably null Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Scaf8 T A 17: 3,197,985 D1194E probably benign Het
Sept12 T C 16: 4,991,943 T198A probably damaging Het
Shisa2 A G 14: 59,630,180 T294A probably damaging Het
Spta1 A G 1: 174,191,062 probably null Het
Strbp A T 2: 37,645,679 S6T probably damaging Het
Syf2 A G 4: 134,934,493 E56G probably damaging Het
Thap4 T C 1: 93,714,866 probably benign Het
Tnfaip3 T C 10: 19,011,832 probably benign Het
Tnxb A G 17: 34,672,540 E619G probably damaging Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Tspan3 G A 9: 56,136,696 R240W probably damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucp1 T C 8: 83,295,247 V236A probably damaging Het
Usp34 TCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCAC 11: 23,364,480 probably benign Het
Zcchc6 G T 13: 59,796,845 T658K probably damaging Het
Zfp940 T C 7: 29,845,438 D348G probably benign Het
Other mutations in Adamdec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Adamdec1 APN 14 68573107 missense probably damaging 1.00
IGL02026:Adamdec1 APN 14 68571802 missense possibly damaging 0.81
IGL02068:Adamdec1 APN 14 68577109 missense probably benign 0.21
IGL02416:Adamdec1 APN 14 68572833 missense probably null 0.99
IGL02739:Adamdec1 APN 14 68570156 nonsense probably null
IGL03078:Adamdec1 APN 14 68568850 missense possibly damaging 0.53
IGL03115:Adamdec1 APN 14 68571353 missense probably damaging 1.00
R0201:Adamdec1 UTSW 14 68581957 critical splice donor site probably null
R0243:Adamdec1 UTSW 14 68581958 critical splice donor site probably null
R0244:Adamdec1 UTSW 14 68568723 nonsense probably null
R0416:Adamdec1 UTSW 14 68568712 missense possibly damaging 0.79
R1373:Adamdec1 UTSW 14 68570951 missense probably damaging 1.00
R1856:Adamdec1 UTSW 14 68570948 missense probably damaging 1.00
R2570:Adamdec1 UTSW 14 68579208 missense probably damaging 0.98
R3684:Adamdec1 UTSW 14 68581998 missense probably benign 0.04
R3755:Adamdec1 UTSW 14 68577138 missense probably damaging 1.00
R4450:Adamdec1 UTSW 14 68573119 missense probably benign 0.00
R4661:Adamdec1 UTSW 14 68570113 missense probably damaging 1.00
R4672:Adamdec1 UTSW 14 68577904 nonsense probably null
R4902:Adamdec1 UTSW 14 68571766 missense probably damaging 0.99
R5017:Adamdec1 UTSW 14 68573245 missense probably benign 0.01
R5018:Adamdec1 UTSW 14 68571779 missense probably damaging 1.00
R5141:Adamdec1 UTSW 14 68573128 missense probably benign 0.00
R5329:Adamdec1 UTSW 14 68570163 missense probably damaging 1.00
R5395:Adamdec1 UTSW 14 68570903 missense probably benign 0.04
R5864:Adamdec1 UTSW 14 68570102 missense probably damaging 1.00
R6032:Adamdec1 UTSW 14 68579184 missense probably damaging 1.00
R6032:Adamdec1 UTSW 14 68579184 missense probably damaging 1.00
R6114:Adamdec1 UTSW 14 68571803 missense probably benign 0.00
R6633:Adamdec1 UTSW 14 68573152 missense probably benign 0.03
R7243:Adamdec1 UTSW 14 68571754 missense probably benign 0.06
R7580:Adamdec1 UTSW 14 68565531 missense probably benign 0.00
X0025:Adamdec1 UTSW 14 68570158 missense probably damaging 1.00
X0050:Adamdec1 UTSW 14 68570158 missense probably damaging 1.00
X0062:Adamdec1 UTSW 14 68573252 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GTCCACTCCTATCTTTGAAAAGTTTGC -3'
(R):5'- TTAGGCTTAAGCTAGCTGGC -3'

Sequencing Primer
(F):5'- GAAAAGTTTGCTGTGATTTCTGACC -3'
(R):5'- GTGTGTGTGTGTAAAAATGCAC -3'
Posted On2015-10-08