Mutagenetix > Incidental Mutation

Incidental Mutation 'R0265:Plxnc1'

34865

Institutional Source

Beutler Lab

Gene Symbol

Plxnc1

Ensembl Gene

ENSMUSG00000074785

Gene Name

plexin C1

Synonyms

CD232, vespr, 2510048K12Rik

MMRRC Submission

038491-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.474) question?

Stock #

R0265 (G1)

Quality Score

108

Status

Validated

Chromosome

Chromosomal Location

94790866-94944835 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 94813129 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 1263 (G1263C)

Ref Sequence

ENSEMBL: ENSMUSP00000096939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099337]

AlphaFold

Q9QZC2

Predicted Effect

probably benign
Transcript: ENSMUST00000099337
AA Change: G1263C

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: G1263C

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Pfam:Sema	87	431	5.5e-10	PFAM
PSI	454	507	5.28e-12	SMART
PSI	590	634	1.07e-3	SMART
Pfam:TIG	665	752	3.7e-9	PFAM
IPT	755	847	5.14e-7	SMART
IPT	849	954	1.8e-2	SMART
low complexity region	978	997	N/A	INTRINSIC
Pfam:Plexin_cytopl	1018	1541	1.4e-199	PFAM

Meta Mutation Damage Score

0.1682

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.6%
20x: 92.0%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	G	14: 8,431,667	Y655S	probably damaging	Het
9330182L06Rik	T	C	5: 9,434,681	L486P	probably damaging	Het
Abca14	A	G	7: 120,223,627	I321V	probably benign	Het
Adcy7	A	G	8: 88,324,763	D837G	probably damaging	Het
Aldh1a1	T	A	19: 20,640,076	Y457*	probably null	Het
Alox5	T	C	6: 116,420,362	Y287C	probably benign	Het
Ano8	T	C	8: 71,480,524		probably benign	Het
Ap3b1	A	G	13: 94,493,681	K815E	unknown	Het
Atp11a	A	T	8: 12,856,930		probably benign	Het
Atp6v0a1	A	T	11: 101,048,515	D702V	possibly damaging	Het
Cacna1b	T	A	2: 24,761,844	N108Y	probably damaging	Het
Ccdc57	G	C	11: 120,921,811	A39G	probably benign	Het
Cdhr1	A	T	14: 37,081,376	V581D	probably benign	Het
Cyp2b23	A	G	7: 26,672,879		probably benign	Het
D430041D05Rik	G	C	2: 104,167,950	P1836R	probably damaging	Het
Ddit4l	C	T	3: 137,624,287		probably benign	Het
Dnah8	A	T	17: 30,690,271	I1024F	probably benign	Het
Edc3	T	A	9: 57,727,338	F213I	probably damaging	Het
Edrf1	G	A	7: 133,657,045	D717N	probably damaging	Het
Efna5	G	A	17: 62,651,073	P63S	probably damaging	Het
Entpd3	A	G	9: 120,558,481	Y248C	probably damaging	Het
Flcn	G	A	11: 59,795,809	Q373*	probably null	Het
Fry	T	C	5: 150,434,776	V1908A	probably damaging	Het
Gabrg3	A	T	7: 57,381,617	Y58*	probably null	Het
Gabrp	A	T	11: 33,552,614	Y417N	probably damaging	Het
Golga2	C	A	2: 32,304,952		probably null	Het
Grip2	C	A	6: 91,773,792		probably null	Het
Gsx2	A	G	5: 75,077,068	Y227C	probably damaging	Het
Hif3a	T	C	7: 17,035,868	*665W	probably null	Het
Hist1h2aa	T	C	13: 23,934,649	V63A	probably benign	Het
Hsd3b1	C	A	3: 98,852,773	V301L	probably damaging	Het
Ifitm5	T	C	7: 140,950,008		probably benign	Het
Inpp4a	A	T	1: 37,378,986	D498V	probably damaging	Het
Itga1	A	T	13: 114,992,459	D554E	probably benign	Het
Itk	G	A	11: 46,389,458		probably benign	Het
Kdm3b	T	A	18: 34,795,663		probably benign	Het
Klhl6	A	G	16: 19,948,234	V470A	probably benign	Het
Lamb3	T	A	1: 193,320,531	W95R	probably damaging	Het
Lbhd2	T	A	12: 111,410,242	I41N	probably damaging	Het
Lrp4	A	T	2: 91,490,670	S1014C	probably damaging	Het
Ltbp2	C	T	12: 84,785,969		probably null	Het
Map3k19	A	G	1: 127,822,182	I1144T	possibly damaging	Het
Mfsd10	T	C	5: 34,635,163		probably benign	Het
Mocos	A	G	18: 24,666,276	D189G	probably benign	Het
Mvb12a	T	A	8: 71,547,010	F224L	probably damaging	Het
Myo15	A	T	11: 60,514,897		probably null	Het
Nos2	A	T	11: 78,937,602	H249L	probably damaging	Het
Notum	A	G	11: 120,658,334	M184T	probably benign	Het
Nvl	C	A	1: 181,134,830	D192Y	probably damaging	Het
Olfr1024	T	A	2: 85,904,247	N269I	probably benign	Het
Olfr1065	C	A	2: 86,445,959	V8L	probably benign	Het
Olfr1308	T	C	2: 111,960,494	Y193C	probably damaging	Het
Olfr204	A	T	16: 59,315,071	F112Y	probably damaging	Het
Olfr218	A	G	1: 173,203,917	K187R	probably benign	Het
Osgin1	A	G	8: 119,445,657	I397V	possibly damaging	Het
Otulin	A	G	15: 27,616,424	V123A	probably damaging	Het
P4ha1	A	G	10: 59,348,259	Y181C	probably damaging	Het
Pcdhgc5	A	T	18: 37,821,350	D559V	probably damaging	Het
Phf2	T	C	13: 48,828,794	N151S	unknown	Het
Rad51ap1	A	G	6: 126,924,197	*338Q	probably null	Het
Raver1	A	G	9: 21,075,659	S676P	probably benign	Het
Rfx8	T	C	1: 39,688,577	E196G	possibly damaging	Het
Rreb1	A	T	13: 37,916,155	K187*	probably null	Het
Rxfp1	T	C	3: 79,667,654	T217A	probably benign	Het
Rxra	T	C	2: 27,752,430	L305P	probably damaging	Het
Sardh	T	C	2: 27,227,066		probably benign	Het
Skor2	A	T	18: 76,876,598	E952D	probably damaging	Het
Slc22a29	A	T	19: 8,169,970	S343T	probably benign	Het
Sorbs2	T	C	8: 45,785,337		probably benign	Het
Supt7l	C	T	5: 31,515,918	V329I	probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tac1	T	C	6: 7,559,165		probably benign	Het
Tcn2	A	T	11: 3,922,044	V361D	probably damaging	Het
Tm2d3	G	A	7: 65,697,834	A170T	possibly damaging	Het
Tnks	G	A	8: 34,839,970	R1142*	probably null	Het
Ttll7	C	A	3: 146,944,160	Y648*	probably null	Het
Umod	G	T	7: 119,466,073	Q578K	probably benign	Het
Upf2	G	A	2: 6,027,204		probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Washc5	A	G	15: 59,338,960	I1013T	probably benign	Het
Wdr60	T	C	12: 116,257,406		probably benign	Het
Zfp704	C	A	3: 9,565,157	R48L	probably damaging	Het

Other mutations in Plxnc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00843:Plxnc1	APN	10	94847549	missense	probably benign	0.25
IGL01285:Plxnc1	APN	10	94799368	missense	probably damaging	0.99
IGL01867:Plxnc1	APN	10	94798146	missense	possibly damaging	0.61
IGL01994:Plxnc1	APN	10	94849939	missense	probably damaging	1.00
IGL02083:Plxnc1	APN	10	94922725	missense	possibly damaging	0.61
IGL02250:Plxnc1	APN	10	94871031	missense	probably benign	0.00
IGL02429:Plxnc1	APN	10	94882591	missense	probably benign	0.00
IGL02752:Plxnc1	APN	10	94794680	splice site	probably null
IGL02973:Plxnc1	APN	10	94810684	missense	probably damaging	1.00
R0230:Plxnc1	UTSW	10	94799347	missense	probably benign	0.07
R0271:Plxnc1	UTSW	10	94837918	missense	probably null	1.00
R0299:Plxnc1	UTSW	10	94849821	critical splice donor site	probably null
R0361:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
R0441:Plxnc1	UTSW	10	94796482	missense	probably damaging	1.00
R0558:Plxnc1	UTSW	10	94837935	missense	probably damaging	1.00
R0617:Plxnc1	UTSW	10	94799368	missense	probably damaging	1.00
R0671:Plxnc1	UTSW	10	94799332	missense	possibly damaging	0.63
R0692:Plxnc1	UTSW	10	94837500	critical splice donor site	probably null
R0751:Plxnc1	UTSW	10	94831333	splice site	probably benign
R1184:Plxnc1	UTSW	10	94831333	splice site	probably benign
R1260:Plxnc1	UTSW	10	94831365	missense	probably damaging	0.99
R1680:Plxnc1	UTSW	10	94841551	missense	probably benign	0.14
R1746:Plxnc1	UTSW	10	94844179	splice site	probably null
R1750:Plxnc1	UTSW	10	94799497	missense	probably damaging	1.00
R1751:Plxnc1	UTSW	10	94849815	unclassified	probably benign
R1768:Plxnc1	UTSW	10	94844322	missense	probably benign	0.05
R1876:Plxnc1	UTSW	10	94866941	missense	possibly damaging	0.94
R2004:Plxnc1	UTSW	10	94852622	missense	probably damaging	0.98
R2031:Plxnc1	UTSW	10	94943667	missense	probably benign	0.26
R2184:Plxnc1	UTSW	10	94944269	missense	probably damaging	1.00
R2437:Plxnc1	UTSW	10	94906533	missense	probably benign	0.02
R2927:Plxnc1	UTSW	10	94793292	critical splice acceptor site	probably null
R3001:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3002:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3003:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3441:Plxnc1	UTSW	10	94871010	missense	probably benign	0.00
R3849:Plxnc1	UTSW	10	94794432	missense	probably benign	0.01
R3884:Plxnc1	UTSW	10	94910687	splice site	probably null
R4004:Plxnc1	UTSW	10	94794597	nonsense	probably null
R4679:Plxnc1	UTSW	10	94794444	missense	probably damaging	1.00
R4730:Plxnc1	UTSW	10	94867468	intron	probably benign
R4937:Plxnc1	UTSW	10	94841473	missense	probably damaging	1.00
R5068:Plxnc1	UTSW	10	94799377	missense	possibly damaging	0.91
R5345:Plxnc1	UTSW	10	94849969	missense	probably benign	0.26
R5397:Plxnc1	UTSW	10	94843752	missense	probably benign	0.08
R5416:Plxnc1	UTSW	10	94837554	missense	probably damaging	1.00
R5485:Plxnc1	UTSW	10	94922742	missense	probably benign	0.00
R5543:Plxnc1	UTSW	10	94864774	missense	probably benign
R5826:Plxnc1	UTSW	10	94799473	critical splice donor site	probably null
R6007:Plxnc1	UTSW	10	94793290	missense	possibly damaging	0.88
R6018:Plxnc1	UTSW	10	94943848	missense	probably benign	0.21
R6052:Plxnc1	UTSW	10	94943773	missense	probably benign	0.13
R6291:Plxnc1	UTSW	10	94833642	splice site	probably null
R6653:Plxnc1	UTSW	10	94943876	missense	probably damaging	1.00
R6984:Plxnc1	UTSW	10	94831530	missense	probably damaging	1.00
R7086:Plxnc1	UTSW	10	94831435	missense	probably benign
R7401:Plxnc1	UTSW	10	94871005	missense	probably benign
R7727:Plxnc1	UTSW	10	94944109	missense	probably damaging	1.00
R7789:Plxnc1	UTSW	10	94794477	missense	probably damaging	1.00
R7803:Plxnc1	UTSW	10	94943515	critical splice donor site	probably null
R7809:Plxnc1	UTSW	10	94794440	missense	probably damaging	1.00
R7882:Plxnc1	UTSW	10	94843836	missense	probably benign
R8103:Plxnc1	UTSW	10	94871082	missense	probably benign
R8226:Plxnc1	UTSW	10	94833368	missense	possibly damaging	0.90
R8273:Plxnc1	UTSW	10	94813243	missense	probably benign	0.14
R8299:Plxnc1	UTSW	10	94827179	missense	probably benign	0.35
R8392:Plxnc1	UTSW	10	94801490	missense	possibly damaging	0.75
R8758:Plxnc1	UTSW	10	94922745	missense	possibly damaging	0.91
R8806:Plxnc1	UTSW	10	94799278	missense	probably damaging	1.00
R8882:Plxnc1	UTSW	10	94841566	missense	probably damaging	1.00
R8893:Plxnc1	UTSW	10	94849847	missense	probably benign	0.35
R8956:Plxnc1	UTSW	10	94910586	missense	probably benign	0.00
R9040:Plxnc1	UTSW	10	94943517	nonsense	probably null
R9102:Plxnc1	UTSW	10	94827245	missense	probably damaging	1.00
R9225:Plxnc1	UTSW	10	94793199	missense	probably damaging	1.00
R9324:Plxnc1	UTSW	10	94944823	start gained	probably benign
R9368:Plxnc1	UTSW	10	94864737	nonsense	probably null
R9375:Plxnc1	UTSW	10	94813231	missense	probably benign	0.20
R9430:Plxnc1	UTSW	10	94922682	missense	probably benign	0.01
R9460:Plxnc1	UTSW	10	94865033	missense	probably benign
R9498:Plxnc1	UTSW	10	94813142	missense	possibly damaging	0.48
RF003:Plxnc1	UTSW	10	94794444	missense	probably damaging	1.00
RF045:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
RF046:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
RF047:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
X0024:Plxnc1	UTSW	10	94864715	critical splice donor site	probably null
Z1176:Plxnc1	UTSW	10	94865029	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GCAGTGTGAAGTGCAACACATCCAG -3'
(R):5'- ACGCGGGTCTCTTATGAATGCC -3'

Sequencing Primer
(F):5'- GGGTCACAATCACATTGATTTGC -3'
(R):5'- GTTACCTCATAGACTTGGGAACC -3'

Posted On

2013-05-09