Incidental Mutation 'R4673:Olfr1449'
ID348655
Institutional Source Beutler Lab
Gene Symbol Olfr1449
Ensembl Gene ENSMUSG00000049498
Gene Nameolfactory receptor 1449
SynonymsGA_x6K02T2RE5P-3264213-3265157, MOR202-34
MMRRC Submission 041928-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4673 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12930840-12935752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12935097 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 120 (A120T)
Ref Sequence ENSEMBL: ENSMUSP00000148934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056005] [ENSMUST00000208624] [ENSMUST00000214079] [ENSMUST00000215325]
Predicted Effect probably damaging
Transcript: ENSMUST00000056005
AA Change: A120T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056181
Gene: ENSMUSG00000049498
AA Change: A120T

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.5e-53 PFAM
Pfam:7tm_1 42 290 3.7e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208624
AA Change: A120T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214079
AA Change: A120T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215325
AA Change: A120T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,884,455 E507G probably damaging Het
Adam39 C T 8: 40,824,731 T53I probably benign Het
Adam4 A T 12: 81,421,761 S29T possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Alas1 G T 9: 106,236,477 P523Q probably damaging Het
Aldh3a1 A G 11: 61,213,494 D69G probably benign Het
Arhgap29 T A 3: 122,014,971 V1266E probably damaging Het
Bcdin3d T C 15: 99,470,838 D160G probably damaging Het
Btaf1 T A 19: 36,978,372 F569I probably benign Het
Cacna1b A G 2: 24,631,944 L1718S probably damaging Het
Casd1 A G 6: 4,629,975 Y457C probably damaging Het
Creb3 T C 4: 43,563,192 V97A probably benign Het
Cux2 G T 5: 121,887,476 S43* probably null Het
Fam160a1 A T 3: 85,730,713 V93D probably damaging Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gm11565 A G 11: 99,915,214 D144G probably benign Het
Gm7534 G A 4: 134,200,347 A365V probably benign Het
Gpn3 A G 5: 122,373,918 Y19C probably damaging Het
Gstz1 A T 12: 87,162,063 T148S probably benign Het
Gtf3c5 A G 2: 28,572,224 I282T probably benign Het
Hspa2 T A 12: 76,405,740 S403T possibly damaging Het
Il27 G A 7: 126,591,079 T121I possibly damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kctd1 T A 18: 15,063,227 probably benign Het
Kynu A G 2: 43,679,803 T366A probably damaging Het
Lama5 G A 2: 180,199,266 T507I probably damaging Het
Myh11 C T 16: 14,269,241 V124M probably damaging Het
Myh14 T A 7: 44,624,330 H1331L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Myh4 T C 11: 67,246,401 F483L probably benign Het
Nbeal1 A C 1: 60,329,390 K2631N probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Ogg1 T C 6: 113,327,307 C28R probably damaging Het
Olfr157 T C 4: 43,836,430 H20R probably benign Het
Olfr181 C T 16: 58,925,690 V294I possibly damaging Het
Olfr49 C T 14: 54,282,332 A188T possibly damaging Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phf14 A G 6: 11,992,057 H744R probably damaging Het
Pibf1 A G 14: 99,133,351 N263S possibly damaging Het
Plcb4 A G 2: 135,932,271 T158A possibly damaging Het
Plce1 T C 19: 38,749,396 S1615P possibly damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rgs22 T A 15: 36,099,933 Y212F probably benign Het
Rnd3 G A 2: 51,132,541 A163V probably benign Het
Rnf10 A T 5: 115,251,089 V315E probably damaging Het
Robo2 C T 16: 73,904,378 probably null Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Scaf8 T A 17: 3,197,985 D1194E probably benign Het
Sept12 T C 16: 4,991,943 T198A probably damaging Het
Shisa2 A G 14: 59,630,180 T294A probably damaging Het
Spta1 A G 1: 174,191,062 probably null Het
Strbp A T 2: 37,645,679 S6T probably damaging Het
Syf2 A G 4: 134,934,493 E56G probably damaging Het
Thap4 T C 1: 93,714,866 probably benign Het
Tnfaip3 T C 10: 19,011,832 probably benign Het
Tnxb A G 17: 34,672,540 E619G probably damaging Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Tspan3 G A 9: 56,136,696 R240W probably damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucp1 T C 8: 83,295,247 V236A probably damaging Het
Usp34 TCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCAC 11: 23,364,480 probably benign Het
Zcchc6 G T 13: 59,796,845 T658K probably damaging Het
Zfp940 T C 7: 29,845,438 D348G probably benign Het
Other mutations in Olfr1449
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Olfr1449 APN 19 12935562 missense probably damaging 0.98
IGL01943:Olfr1449 APN 19 12935674 missense probably benign 0.24
IGL02966:Olfr1449 APN 19 12934800 missense probably benign 0.08
IGL02974:Olfr1449 APN 19 12935035 missense probably benign 0.02
IGL03220:Olfr1449 APN 19 12935494 missense probably damaging 1.00
PIT4531001:Olfr1449 UTSW 19 12935277 missense probably damaging 0.98
R0285:Olfr1449 UTSW 19 12935172 missense probably benign 0.00
R0573:Olfr1449 UTSW 19 12935260 missense possibly damaging 0.77
R0588:Olfr1449 UTSW 19 12934747 missense probably benign 0.00
R0726:Olfr1449 UTSW 19 12935605 missense probably damaging 1.00
R1006:Olfr1449 UTSW 19 12935274 missense probably damaging 1.00
R1146:Olfr1449 UTSW 19 12934965 missense possibly damaging 0.77
R1146:Olfr1449 UTSW 19 12934965 missense possibly damaging 0.77
R1386:Olfr1449 UTSW 19 12935139 missense probably benign 0.17
R1735:Olfr1449 UTSW 19 12934843 missense probably damaging 1.00
R1794:Olfr1449 UTSW 19 12934968 missense probably damaging 0.97
R2355:Olfr1449 UTSW 19 12935019 missense possibly damaging 0.91
R2511:Olfr1449 UTSW 19 12935173 missense possibly damaging 0.85
R4749:Olfr1449 UTSW 19 12935217 missense probably benign 0.02
R4765:Olfr1449 UTSW 19 12935076 missense possibly damaging 0.65
R5112:Olfr1449 UTSW 19 12934816 missense probably benign 0.01
R5958:Olfr1449 UTSW 19 12935047 missense probably damaging 1.00
R6115:Olfr1449 UTSW 19 12935584 missense possibly damaging 0.54
R6152:Olfr1449 UTSW 19 12935487 missense probably benign 0.13
R6417:Olfr1449 UTSW 19 12935220 missense probably damaging 1.00
R6420:Olfr1449 UTSW 19 12935220 missense probably damaging 1.00
R6695:Olfr1449 UTSW 19 12935400 missense possibly damaging 0.95
R6963:Olfr1449 UTSW 19 12935638 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGGAATCTGGGCATTATCG -3'
(R):5'- GTGATGAACCACATTAGCACAG -3'

Sequencing Primer
(F):5'- GATATGGCTGGACTTCCGC -3'
(R):5'- CCACATTAGCACAGTAGGGG -3'
Posted On2015-10-08