Mutagenetix > Incidental Mutation

Incidental Mutation 'R4674:Atp1a4'

348667

Institutional Source

Beutler Lab

Gene Symbol

Atp1a4

Ensembl Gene

ENSMUSG00000007107

Gene Name

ATPase, Na+/K+ transporting, alpha 4 polypeptide

Synonyms

MMRRC Submission

041929-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4674 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

172223513-172258414 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 172257656 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 66 (V66E)

Ref Sequence

ENSEMBL: ENSMUSP00000106874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111243] [ENSMUST00000139528]

AlphaFold

Q9WV27

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111243
AA Change: V66E

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: V66E

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139528

SMART Domains

Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034

Domain	Start	End	E-Value	Type
IG_like	19	84	3.66e1	SMART
low complexity region	92	103	N/A	INTRINSIC
IG	106	222	2.3e-3	SMART
IG	246	370	9.49e-5	SMART
IG	382	508	3.59e-5	SMART
transmembrane domain	515	537	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193316

Meta Mutation Damage Score

0.4640

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	C	5: 8,810,615	I112T	probably benign	Het
Acvr1b	T	C	15: 101,203,058	I367T	possibly damaging	Het
Akr1b8	G	A	6: 34,356,424		probably null	Het
Ash1l	T	C	3: 89,072,476	V2769A	possibly damaging	Het
Asxl3	A	T	18: 22,517,738	D928V	probably damaging	Het
Cald1	AAGAGAGAGAGAGAG	AAGAGAGAGAGAG	6: 34,746,173		probably null	Het
Cbx2	T	A	11: 119,029,109	I500N	probably damaging	Het
Ccdc82	A	T	9: 13,252,635	H184L	probably benign	Het
Cd84	A	T	1: 171,873,320	H216L	possibly damaging	Het
Ceacam15	T	C	7: 16,673,485	T36A	probably benign	Het
Cebpd	A	G	16: 15,887,521	D66G	probably damaging	Het
Clec1b	C	A	6: 129,400,134	L47I	probably damaging	Het
Cracr2b	A	G	7: 141,463,538	D43G	probably damaging	Het
Crbn	T	A	6: 106,790,971	Q173L	possibly damaging	Het
Cspg4	T	C	9: 56,898,205	V2100A	probably damaging	Het
Cyp46a1	T	C	12: 108,358,086	L374P	probably damaging	Het
Dhx16	T	A	17: 35,885,939	V607E	probably damaging	Het
Dido1	A	G	2: 180,687,559	S357P	probably damaging	Het
Dnah6	T	A	6: 73,192,422	I399F	probably benign	Het
Dock10	T	C	1: 80,606,620	E123G	possibly damaging	Het
Dstyk	A	G	1: 132,463,390	D843G	probably benign	Het
Efcab12	C	A	6: 115,823,649	V138F	probably damaging	Het
Egf	A	G	3: 129,718,040	F493L	probably damaging	Het
Ephx1	A	G	1: 180,994,691	F220S	probably damaging	Het
Exoc6	T	C	19: 37,609,082	F644L	probably damaging	Het
F13b	A	G	1: 139,501,804	Y20C	unknown	Het
Fam184b	T	A	5: 45,582,888	K319*	probably null	Het
Fam208b	T	C	13: 3,573,686	E1406G	possibly damaging	Het
Flrt2	T	A	12: 95,780,688	L600*	probably null	Het
Gbgt1	T	C	2: 28,498,441	F46S	possibly damaging	Het
Gli2	T	C	1: 118,836,029	E1464G	probably damaging	Het
Gm21731	T	C	13: 120,240,826	W53R	probably damaging	Het
H2afy	A	C	13: 56,083,184	C297G	possibly damaging	Het
Hdac9	A	G	12: 34,373,960	V501A	possibly damaging	Het
Heca	T	C	10: 17,915,309	H333R	probably benign	Het
Hirip3	G	A	7: 126,864,662		probably null	Het
Igsf8	G	A	1: 172,318,912	W51*	probably null	Het
Kif21a	C	A	15: 90,940,545	R1342L	possibly damaging	Het
Krt73	T	C	15: 101,802,075	N75D	probably benign	Het
Macf1	T	A	4: 123,472,397	Y1292F	probably benign	Het
Mapk14	A	G	17: 28,745,022		probably null	Het
Mgat5	T	A	1: 127,390,758	V330D	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Naip1	A	T	13: 100,444,174	F188L	probably damaging	Het
Ncoa3	T	C	2: 166,059,811	S1035P	probably benign	Het
Ndn	T	A	7: 62,348,822	W139R	probably damaging	Het
Nes	T	C	3: 87,971,795	V198A	possibly damaging	Het
Olfr1212	G	T	2: 88,958,872	M135I	probably damaging	Het
Olfr1260	A	G	2: 89,977,906	I43V	possibly damaging	Het
Olfr1465	T	A	19: 13,313,814	H157L	probably benign	Het
Olfr497	T	C	7: 108,423,102	V177A	possibly damaging	Het
Olfr613	T	G	7: 103,551,976	L64V	probably damaging	Het
Olfr656	T	A	7: 104,618,424	C248*	probably null	Het
Pcf11	G	A	7: 92,659,777		probably benign	Het
Pde1a	TCC	TC	2: 79,898,181		probably benign	Het
Pipox	T	G	11: 77,893,770	Q4P	probably benign	Het
Pla2g4c	C	T	7: 13,343,514	T327I	probably null	Het
Plppr1	C	T	4: 49,323,384	R225W	probably damaging	Het
Pnpla6	T	A	8: 3,521,412	V145D	probably damaging	Het
Pnpla7	T	C	2: 25,052,317	Y83H	probably damaging	Het
Rif1	T	A	2: 52,106,942	L970Q	probably null	Het
Rimklb	C	A	6: 122,456,283	E303*	probably null	Het
Rpl13a	A	T	7: 45,126,818		probably benign	Het
Rttn	T	A	18: 89,011,011		probably null	Het
Sf3b3	G	A	8: 110,844,505	R10W	probably damaging	Het
Skint4	G	A	4: 112,118,233	C130Y	probably damaging	Het
Snap91	A	G	9: 86,792,017	S593P	possibly damaging	Het
Ssb	A	G	2: 69,868,850	Q209R	probably benign	Het
Stap1	A	T	5: 86,081,185	I71L	probably benign	Het
Syna	C	A	5: 134,558,355	R580L	probably damaging	Het
Tacc2	T	A	7: 130,624,861	M1111K	possibly damaging	Het
Tanc2	T	C	11: 105,867,480	L689P	probably damaging	Het
Tdrd5	A	C	1: 156,277,435	C463W	probably damaging	Het
Tet1	A	G	10: 62,838,848	F1150L	probably damaging	Het
Tia1	T	A	6: 86,420,400	F118L	probably damaging	Het
Trav3-1	A	T	14: 52,581,003	T45S	possibly damaging	Het
Uaca	A	T	9: 60,854,429	Y235F	possibly damaging	Het
Ube4b	T	C	4: 149,331,370	N44S	possibly damaging	Het
Vmn2r93	T	A	17: 18,304,993	H304Q	probably benign	Het
Wdr18	A	G	10: 79,965,235	I161V	probably benign	Het
Zfp112	A	G	7: 24,126,974	H789R	probably damaging	Het
Zfp873	A	G	10: 82,059,980	T182A	possibly damaging	Het
Zscan2	T	A	7: 80,875,402	S290R	probably damaging	Het
Zufsp	A	T	10: 33,948,984	D167E	possibly damaging	Het

Other mutations in Atp1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Atp1a4	APN	1	172239806	missense	probably damaging	1.00
IGL00924:Atp1a4	APN	1	172246772	missense	probably damaging	1.00
IGL01288:Atp1a4	APN	1	172257907	missense	possibly damaging	0.77
IGL01665:Atp1a4	APN	1	172246724	missense	probably benign
IGL02156:Atp1a4	APN	1	172257962	missense	probably benign
IGL02170:Atp1a4	APN	1	172234536	missense	possibly damaging	0.94
IGL02228:Atp1a4	APN	1	172254885	missense	possibly damaging	0.69
IGL02505:Atp1a4	APN	1	172235075	missense	probably damaging	1.00
IGL02653:Atp1a4	APN	1	172251406	missense	possibly damaging	0.81
IGL02792:Atp1a4	APN	1	172227299	critical splice donor site	probably null
IGL02794:Atp1a4	APN	1	172244086	missense	probably benign	0.13
IGL03102:Atp1a4	APN	1	172231151	missense	probably damaging	1.00
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0276:Atp1a4	UTSW	1	172257901	missense	probably damaging	1.00
R0309:Atp1a4	UTSW	1	172234987	missense	probably damaging	1.00
R0525:Atp1a4	UTSW	1	172239688	splice site	probably benign
R0615:Atp1a4	UTSW	1	172232060	splice site	probably benign
R0730:Atp1a4	UTSW	1	172240207	splice site	probably benign
R1412:Atp1a4	UTSW	1	172232009	missense	probably damaging	0.97
R1652:Atp1a4	UTSW	1	172254903	missense	probably damaging	1.00
R1898:Atp1a4	UTSW	1	172235048	missense	probably damaging	0.99
R1968:Atp1a4	UTSW	1	172240164	missense	probably benign
R2291:Atp1a4	UTSW	1	172244906	missense	probably damaging	1.00
R2897:Atp1a4	UTSW	1	172246690	missense	probably damaging	1.00
R2908:Atp1a4	UTSW	1	172234477	missense	probably benign
R3119:Atp1a4	UTSW	1	172239826	missense	probably damaging	0.99
R3731:Atp1a4	UTSW	1	172233961	missense	probably damaging	1.00
R4447:Atp1a4	UTSW	1	172234431	missense	probably damaging	0.99
R4602:Atp1a4	UTSW	1	172239765	missense	probably damaging	1.00
R4670:Atp1a4	UTSW	1	172235000	missense	probably benign	0.07
R4675:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4785:Atp1a4	UTSW	1	172254110	nonsense	probably null
R4958:Atp1a4	UTSW	1	172231151	missense	probably damaging	1.00
R5015:Atp1a4	UTSW	1	172254082	missense	probably damaging	1.00
R5149:Atp1a4	UTSW	1	172232005	missense	probably damaging	1.00
R5234:Atp1a4	UTSW	1	172227170	missense	possibly damaging	0.73
R5501:Atp1a4	UTSW	1	172246832	missense	probably damaging	1.00
R5682:Atp1a4	UTSW	1	172254163	missense	probably damaging	0.99
R5872:Atp1a4	UTSW	1	172244408	missense	probably damaging	1.00
R5933:Atp1a4	UTSW	1	172232274	missense	possibly damaging	0.91
R6722:Atp1a4	UTSW	1	172258050	unclassified	probably benign
R7087:Atp1a4	UTSW	1	172246702	missense	probably damaging	1.00
R7122:Atp1a4	UTSW	1	172231936	missense	possibly damaging	0.47
R7381:Atp1a4	UTSW	1	172240115	missense	possibly damaging	0.70
R7431:Atp1a4	UTSW	1	172250907	missense	probably benign	0.31
R8269:Atp1a4	UTSW	1	172232325	missense	probably damaging	1.00
R8400:Atp1a4	UTSW	1	172234494	missense	probably damaging	1.00
R8559:Atp1a4	UTSW	1	172251330	missense	probably damaging	1.00
R8680:Atp1a4	UTSW	1	172250999	missense	probably damaging	1.00
R8777:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8777-TAIL:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8867:Atp1a4	UTSW	1	172244924	missense	probably damaging	0.99
R8869:Atp1a4	UTSW	1	172227123	missense	probably benign
R9260:Atp1a4	UTSW	1	172246792	missense	probably damaging	1.00
R9300:Atp1a4	UTSW	1	172239831	missense	probably damaging	1.00
R9545:Atp1a4	UTSW	1	172250897	missense	probably benign	0.35
Z1176:Atp1a4	UTSW	1	172231954	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- TCCAAGTAGAGTTGTGTGGAGC -3'
(R):5'- TTATGGTGAGGATGGCCAAAGC -3'

Sequencing Primer
(F):5'- AGCTTTGCGGGGCTAAG -3'
(R):5'- TGCCCTTGAAAGACCCTTCAG -3'

Posted On

2015-10-08