Incidental Mutation 'R4674:Ash1l'
ID348679
Institutional Source Beutler Lab
Gene Symbol Ash1l
Ensembl Gene ENSMUSG00000028053
Gene NameASH1 like histone lysine methyltransferase
Synonymschromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik
MMRRC Submission 041929-MU
Accession Numbers

Genbank: NM_138679; MGI: 2183158

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4674 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88950622-89079375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89072476 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2769 (V2769A)
Ref Sequence ENSEMBL: ENSMUSP00000140251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090933
AA Change: V2769A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: V2769A

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186583
AA Change: V2769A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: V2769A

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,810,615 I112T probably benign Het
Acvr1b T C 15: 101,203,058 I367T possibly damaging Het
Akr1b8 G A 6: 34,356,424 probably null Het
Asxl3 A T 18: 22,517,738 D928V probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Ccdc82 A T 9: 13,252,635 H184L probably benign Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Clec1b C A 6: 129,400,134 L47I probably damaging Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Crbn T A 6: 106,790,971 Q173L possibly damaging Het
Cspg4 T C 9: 56,898,205 V2100A probably damaging Het
Cyp46a1 T C 12: 108,358,086 L374P probably damaging Het
Dhx16 T A 17: 35,885,939 V607E probably damaging Het
Dido1 A G 2: 180,687,559 S357P probably damaging Het
Dnah6 T A 6: 73,192,422 I399F probably benign Het
Dock10 T C 1: 80,606,620 E123G possibly damaging Het
Dstyk A G 1: 132,463,390 D843G probably benign Het
Efcab12 C A 6: 115,823,649 V138F probably damaging Het
Egf A G 3: 129,718,040 F493L probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
Exoc6 T C 19: 37,609,082 F644L probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fam184b T A 5: 45,582,888 K319* probably null Het
Fam208b T C 13: 3,573,686 E1406G possibly damaging Het
Flrt2 T A 12: 95,780,688 L600* probably null Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gli2 T C 1: 118,836,029 E1464G probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
H2afy A C 13: 56,083,184 C297G possibly damaging Het
Hdac9 A G 12: 34,373,960 V501A possibly damaging Het
Heca T C 10: 17,915,309 H333R probably benign Het
Hirip3 G A 7: 126,864,662 probably null Het
Igsf8 G A 1: 172,318,912 W51* probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Krt73 T C 15: 101,802,075 N75D probably benign Het
Macf1 T A 4: 123,472,397 Y1292F probably benign Het
Mapk14 A G 17: 28,745,022 probably null Het
Mgat5 T A 1: 127,390,758 V330D probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,444,174 F188L probably damaging Het
Ncoa3 T C 2: 166,059,811 S1035P probably benign Het
Ndn T A 7: 62,348,822 W139R probably damaging Het
Nes T C 3: 87,971,795 V198A possibly damaging Het
Olfr1212 G T 2: 88,958,872 M135I probably damaging Het
Olfr1260 A G 2: 89,977,906 I43V possibly damaging Het
Olfr1465 T A 19: 13,313,814 H157L probably benign Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Pcf11 G A 7: 92,659,777 probably benign Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Pipox T G 11: 77,893,770 Q4P probably benign Het
Pla2g4c C T 7: 13,343,514 T327I probably null Het
Plppr1 C T 4: 49,323,384 R225W probably damaging Het
Pnpla6 T A 8: 3,521,412 V145D probably damaging Het
Pnpla7 T C 2: 25,052,317 Y83H probably damaging Het
Rif1 T A 2: 52,106,942 L970Q probably null Het
Rimklb C A 6: 122,456,283 E303* probably null Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rttn T A 18: 89,011,011 probably null Het
Sf3b3 G A 8: 110,844,505 R10W probably damaging Het
Skint4 G A 4: 112,118,233 C130Y probably damaging Het
Snap91 A G 9: 86,792,017 S593P possibly damaging Het
Ssb A G 2: 69,868,850 Q209R probably benign Het
Stap1 A T 5: 86,081,185 I71L probably benign Het
Syna C A 5: 134,558,355 R580L probably damaging Het
Tacc2 T A 7: 130,624,861 M1111K possibly damaging Het
Tanc2 T C 11: 105,867,480 L689P probably damaging Het
Tdrd5 A C 1: 156,277,435 C463W probably damaging Het
Tet1 A G 10: 62,838,848 F1150L probably damaging Het
Tia1 T A 6: 86,420,400 F118L probably damaging Het
Trav3-1 A T 14: 52,581,003 T45S possibly damaging Het
Uaca A T 9: 60,854,429 Y235F possibly damaging Het
Ube4b T C 4: 149,331,370 N44S possibly damaging Het
Vmn2r93 T A 17: 18,304,993 H304Q probably benign Het
Wdr18 A G 10: 79,965,235 I161V probably benign Het
Zfp112 A G 7: 24,126,974 H789R probably damaging Het
Zfp873 A G 10: 82,059,980 T182A possibly damaging Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Zufsp A T 10: 33,948,984 D167E possibly damaging Het
Other mutations in Ash1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ash1l APN 3 88981712 missense probably benign 0.19
IGL00819:Ash1l APN 3 89007736 missense possibly damaging 0.68
IGL00939:Ash1l APN 3 89035236 missense probably damaging 0.99
IGL01064:Ash1l APN 3 89072484 missense probably damaging 1.00
IGL01066:Ash1l APN 3 88984635 missense probably damaging 1.00
IGL01087:Ash1l APN 3 89063902 missense probably damaging 1.00
IGL01293:Ash1l APN 3 88983529 missense probably benign 0.01
IGL01541:Ash1l APN 3 89066265 missense probably damaging 1.00
IGL01863:Ash1l APN 3 88985506 nonsense probably null
IGL02326:Ash1l APN 3 88966057 missense probably benign 0.00
IGL02407:Ash1l APN 3 89072548 missense probably damaging 1.00
IGL02419:Ash1l APN 3 88985565 missense probably benign 0.00
IGL02422:Ash1l APN 3 89069079 critical splice donor site probably null
IGL02494:Ash1l APN 3 89066218 nonsense probably null
IGL02727:Ash1l APN 3 89023037 missense probably benign
IGL02732:Ash1l APN 3 88966228 missense probably damaging 1.00
IGL02817:Ash1l APN 3 88984801 missense probably damaging 1.00
IGL02887:Ash1l APN 3 88984181 missense probably benign 0.11
IGL03224:Ash1l APN 3 89035268 splice site probably benign
IGL03253:Ash1l APN 3 88984674 missense probably damaging 1.00
IGL03327:Ash1l APN 3 89023083 missense probably benign 0.02
IGL03398:Ash1l APN 3 89007220 missense probably benign 0.01
3-1:Ash1l UTSW 3 88966326 missense probably benign
R0068:Ash1l UTSW 3 89007317 missense probably benign 0.17
R0068:Ash1l UTSW 3 89007317 missense probably benign 0.17
R0239:Ash1l UTSW 3 89067222 missense possibly damaging 0.49
R0239:Ash1l UTSW 3 89067222 missense possibly damaging 0.49
R0395:Ash1l UTSW 3 89058589 missense probably damaging 1.00
R0477:Ash1l UTSW 3 88983459 missense probably benign 0.41
R0528:Ash1l UTSW 3 88982277 missense probably benign
R0543:Ash1l UTSW 3 89063778 splice site probably null
R0855:Ash1l UTSW 3 89054454 missense possibly damaging 0.82
R1147:Ash1l UTSW 3 88984887 missense possibly damaging 0.72
R1147:Ash1l UTSW 3 88984887 missense possibly damaging 0.72
R1163:Ash1l UTSW 3 89035263 critical splice donor site probably null
R1196:Ash1l UTSW 3 88983316 missense probably damaging 0.99
R1419:Ash1l UTSW 3 88984897 missense probably damaging 0.99
R1445:Ash1l UTSW 3 89007352 missense probably benign 0.02
R1466:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1466:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1480:Ash1l UTSW 3 88985052 missense probably damaging 1.00
R1506:Ash1l UTSW 3 89058499 missense probably damaging 0.99
R1537:Ash1l UTSW 3 89072476 missense probably damaging 0.99
R1584:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1669:Ash1l UTSW 3 89067242 critical splice donor site probably null
R1713:Ash1l UTSW 3 89076224 missense probably damaging 1.00
R1780:Ash1l UTSW 3 88965984 missense probably benign
R1793:Ash1l UTSW 3 89070309 missense probably damaging 1.00
R1881:Ash1l UTSW 3 88981555 missense probably benign 0.00
R1909:Ash1l UTSW 3 88984528 missense probably benign 0.29
R1938:Ash1l UTSW 3 88984422 missense probably damaging 0.98
R2035:Ash1l UTSW 3 89066317 missense probably benign 0.00
R2070:Ash1l UTSW 3 88966203 missense probably damaging 1.00
R2071:Ash1l UTSW 3 88966203 missense probably damaging 1.00
R2114:Ash1l UTSW 3 88983264 missense probably benign 0.00
R2116:Ash1l UTSW 3 88983264 missense probably benign 0.00
R2118:Ash1l UTSW 3 88985295 missense possibly damaging 0.80
R2143:Ash1l UTSW 3 88985419 missense probably benign 0.09
R2164:Ash1l UTSW 3 88985419 missense probably benign 0.09
R2210:Ash1l UTSW 3 89066298 missense probably damaging 1.00
R2247:Ash1l UTSW 3 89007367 missense possibly damaging 0.77
R2303:Ash1l UTSW 3 89026426 missense probably damaging 1.00
R2860:Ash1l UTSW 3 89054478 missense probably damaging 1.00
R2861:Ash1l UTSW 3 89054478 missense probably damaging 1.00
R3104:Ash1l UTSW 3 89054386 missense probably damaging 1.00
R4133:Ash1l UTSW 3 88982260 missense probably benign 0.00
R4164:Ash1l UTSW 3 88981966 missense probably damaging 0.97
R4270:Ash1l UTSW 3 88982040 missense probably benign 0.26
R4271:Ash1l UTSW 3 88982040 missense probably benign 0.26
R4287:Ash1l UTSW 3 89066415 missense probably damaging 0.99
R4409:Ash1l UTSW 3 89007199 missense probably damaging 0.99
R4459:Ash1l UTSW 3 88966234 missense probably damaging 0.99
R4487:Ash1l UTSW 3 88985315 missense possibly damaging 0.65
R4739:Ash1l UTSW 3 88982845 missense probably benign 0.19
R4927:Ash1l UTSW 3 88985334 missense probably damaging 1.00
R5000:Ash1l UTSW 3 89058634 missense probably damaging 1.00
R5016:Ash1l UTSW 3 88982323 missense probably damaging 1.00
R5055:Ash1l UTSW 3 89023212 critical splice donor site probably null
R5081:Ash1l UTSW 3 88984717 missense probably damaging 1.00
R5082:Ash1l UTSW 3 88966234 missense probably damaging 0.99
R5090:Ash1l UTSW 3 89052877 missense probably damaging 1.00
R5113:Ash1l UTSW 3 89066275 missense probably damaging 0.99
R5408:Ash1l UTSW 3 88982394 missense probably damaging 1.00
R5452:Ash1l UTSW 3 88984876 missense possibly damaging 0.93
R5487:Ash1l UTSW 3 88981426 missense probably benign 0.17
R5610:Ash1l UTSW 3 89023185 missense probably damaging 1.00
R5624:Ash1l UTSW 3 88985609 missense probably damaging 1.00
R5682:Ash1l UTSW 3 89007607 missense probably damaging 0.99
R5712:Ash1l UTSW 3 89051990 missense probably damaging 0.99
R5719:Ash1l UTSW 3 89054498 missense possibly damaging 0.83
R5719:Ash1l UTSW 3 89058626 missense probably damaging 1.00
R5839:Ash1l UTSW 3 88983351 missense probably damaging 0.99
R5859:Ash1l UTSW 3 89068993 missense probably damaging 1.00
R5877:Ash1l UTSW 3 88981584 missense probably benign 0.00
R5940:Ash1l UTSW 3 88984036 missense probably damaging 0.96
R6026:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6027:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6029:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6033:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6033:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6034:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6034:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6035:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6035:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6089:Ash1l UTSW 3 89053143 nonsense probably null
R6110:Ash1l UTSW 3 88985129 missense probably damaging 1.00
R6168:Ash1l UTSW 3 89052773 nonsense probably null
R6200:Ash1l UTSW 3 89070527 missense probably damaging 1.00
R6290:Ash1l UTSW 3 88982761 nonsense probably null
R6331:Ash1l UTSW 3 89007865 missense probably benign 0.00
R6425:Ash1l UTSW 3 88983780 missense probably damaging 0.99
R6540:Ash1l UTSW 3 88985061 missense probably damaging 1.00
R6568:Ash1l UTSW 3 89052037 missense probably benign 0.09
R6828:Ash1l UTSW 3 89076113 missense probably benign 0.00
R6843:Ash1l UTSW 3 88985388 missense probably damaging 1.00
R6894:Ash1l UTSW 3 88982991 missense probably benign 0.00
R6976:Ash1l UTSW 3 88981657 missense possibly damaging 0.77
R7038:Ash1l UTSW 3 88982671 missense probably benign 0.00
R7073:Ash1l UTSW 3 88985340 missense probably damaging 1.00
R7133:Ash1l UTSW 3 88983457 frame shift probably null
R7150:Ash1l UTSW 3 89077074 missense probably damaging 1.00
R7205:Ash1l UTSW 3 88965952 missense probably benign 0.00
R7254:Ash1l UTSW 3 89070509 missense probably damaging 1.00
R7272:Ash1l UTSW 3 89054634 intron probably null
R7288:Ash1l UTSW 3 88965892 start gained probably benign
R7319:Ash1l UTSW 3 88981387 missense probably benign 0.19
R7341:Ash1l UTSW 3 88981759 missense possibly damaging 0.93
R7342:Ash1l UTSW 3 88965997 missense possibly damaging 0.94
R7454:Ash1l UTSW 3 88983865 missense probably benign 0.16
R7677:Ash1l UTSW 3 89043193 missense probably damaging 1.00
X0017:Ash1l UTSW 3 88984585 missense probably benign 0.45
X0019:Ash1l UTSW 3 89070556 missense probably damaging 1.00
X0021:Ash1l UTSW 3 88983204 missense probably benign 0.10
Z1088:Ash1l UTSW 3 88982709 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACTGGGTTGATTTTGGAAAC -3'
(R):5'- AGCAAGGCCTCAAGCATTATG -3'

Sequencing Primer
(F):5'- CAGGGCTTCTCTATATAGACCAGG -3'
(R):5'- TTCATGATCAGCTGAACCAAGTGG -3'
Posted On2015-10-08