Incidental Mutation 'R0265:Flcn'
ID34868
Institutional Source Beutler Lab
Gene Symbol Flcn
Ensembl Gene ENSMUSG00000032633
Gene Namefolliculin
SynonymsB430214A04Rik, BHD
MMRRC Submission 038491-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0265 (G1)
Quality Score186
Status Validated
Chromosome11
Chromosomal Location59791408-59810016 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 59795809 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 373 (Q373*)
Ref Sequence ENSEMBL: ENSMUSP00000099758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091246] [ENSMUST00000102697]
Predicted Effect probably null
Transcript: ENSMUST00000091246
AA Change: Q373*
SMART Domains Protein: ENSMUSP00000091696
Gene: ENSMUSG00000032633
AA Change: Q373*

DomainStartEndE-ValueType
low complexity region 62 79 N/A INTRINSIC
Pfam:Folliculin 103 267 3.5e-59 PFAM
low complexity region 293 308 N/A INTRINSIC
PDB:3V42|B 342 566 1e-144 PDB
Predicted Effect probably null
Transcript: ENSMUST00000102697
AA Change: Q373*
SMART Domains Protein: ENSMUSP00000099758
Gene: ENSMUSG00000032633
AA Change: Q373*

DomainStartEndE-ValueType
low complexity region 62 79 N/A INTRINSIC
Pfam:Folliculin 104 265 1.5e-55 PFAM
low complexity region 293 308 N/A INTRINSIC
Pfam:Folliculin_C 344 566 8.4e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148151
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.6%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two different knock-out alleles exhibit prenatal lethality. Mice homozygous for a gene-trapped allele show prenatal lethality while a fraction of heterozygotes develop spontaneous oncocytic renal cysts and solid renal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T G 14: 8,431,667 Y655S probably damaging Het
9330182L06Rik T C 5: 9,434,681 L486P probably damaging Het
Abca14 A G 7: 120,223,627 I321V probably benign Het
Adcy7 A G 8: 88,324,763 D837G probably damaging Het
Aldh1a1 T A 19: 20,640,076 Y457* probably null Het
Alox5 T C 6: 116,420,362 Y287C probably benign Het
Ano8 T C 8: 71,480,524 probably benign Het
Ap3b1 A G 13: 94,493,681 K815E unknown Het
Atp11a A T 8: 12,856,930 probably benign Het
Atp6v0a1 A T 11: 101,048,515 D702V possibly damaging Het
Cacna1b T A 2: 24,761,844 N108Y probably damaging Het
Ccdc57 G C 11: 120,921,811 A39G probably benign Het
Cdhr1 A T 14: 37,081,376 V581D probably benign Het
Cyp2b23 A G 7: 26,672,879 probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Ddit4l C T 3: 137,624,287 probably benign Het
Dnah8 A T 17: 30,690,271 I1024F probably benign Het
Edc3 T A 9: 57,727,338 F213I probably damaging Het
Edrf1 G A 7: 133,657,045 D717N probably damaging Het
Efna5 G A 17: 62,651,073 P63S probably damaging Het
Entpd3 A G 9: 120,558,481 Y248C probably damaging Het
Fry T C 5: 150,434,776 V1908A probably damaging Het
Gabrg3 A T 7: 57,381,617 Y58* probably null Het
Gabrp A T 11: 33,552,614 Y417N probably damaging Het
Golga2 C A 2: 32,304,952 probably null Het
Grip2 C A 6: 91,773,792 probably null Het
Gsx2 A G 5: 75,077,068 Y227C probably damaging Het
Hif3a T C 7: 17,035,868 *665W probably null Het
Hist1h2aa T C 13: 23,934,649 V63A probably benign Het
Hsd3b1 C A 3: 98,852,773 V301L probably damaging Het
Ifitm5 T C 7: 140,950,008 probably benign Het
Inpp4a A T 1: 37,378,986 D498V probably damaging Het
Itga1 A T 13: 114,992,459 D554E probably benign Het
Itk G A 11: 46,389,458 probably benign Het
Kdm3b T A 18: 34,795,663 probably benign Het
Klhl6 A G 16: 19,948,234 V470A probably benign Het
Lamb3 T A 1: 193,320,531 W95R probably damaging Het
Lbhd2 T A 12: 111,410,242 I41N probably damaging Het
Lrp4 A T 2: 91,490,670 S1014C probably damaging Het
Ltbp2 C T 12: 84,785,969 probably null Het
Map3k19 A G 1: 127,822,182 I1144T possibly damaging Het
Mfsd10 T C 5: 34,635,163 probably benign Het
Mocos A G 18: 24,666,276 D189G probably benign Het
Mvb12a T A 8: 71,547,010 F224L probably damaging Het
Myo15 A T 11: 60,514,897 probably null Het
Nos2 A T 11: 78,937,602 H249L probably damaging Het
Notum A G 11: 120,658,334 M184T probably benign Het
Nvl C A 1: 181,134,830 D192Y probably damaging Het
Olfr1024 T A 2: 85,904,247 N269I probably benign Het
Olfr1065 C A 2: 86,445,959 V8L probably benign Het
Olfr1308 T C 2: 111,960,494 Y193C probably damaging Het
Olfr204 A T 16: 59,315,071 F112Y probably damaging Het
Olfr218 A G 1: 173,203,917 K187R probably benign Het
Osgin1 A G 8: 119,445,657 I397V possibly damaging Het
Otulin A G 15: 27,616,424 V123A probably damaging Het
P4ha1 A G 10: 59,348,259 Y181C probably damaging Het
Pcdhgc5 A T 18: 37,821,350 D559V probably damaging Het
Phf2 T C 13: 48,828,794 N151S unknown Het
Plxnc1 C A 10: 94,813,129 G1263C probably benign Het
Rad51ap1 A G 6: 126,924,197 *338Q probably null Het
Raver1 A G 9: 21,075,659 S676P probably benign Het
Rfx8 T C 1: 39,688,577 E196G possibly damaging Het
Rreb1 A T 13: 37,916,155 K187* probably null Het
Rxfp1 T C 3: 79,667,654 T217A probably benign Het
Rxra T C 2: 27,752,430 L305P probably damaging Het
Sardh T C 2: 27,227,066 probably benign Het
Skor2 A T 18: 76,876,598 E952D probably damaging Het
Slc22a29 A T 19: 8,169,970 S343T probably benign Het
Sorbs2 T C 8: 45,785,337 probably benign Het
Supt7l C T 5: 31,515,918 V329I probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 T C 6: 7,559,165 probably benign Het
Tcn2 A T 11: 3,922,044 V361D probably damaging Het
Tm2d3 G A 7: 65,697,834 A170T possibly damaging Het
Tnks G A 8: 34,839,970 R1142* probably null Het
Ttll7 C A 3: 146,944,160 Y648* probably null Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Upf2 G A 2: 6,027,204 probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Washc5 A G 15: 59,338,960 I1013T probably benign Het
Wdr60 T C 12: 116,257,406 probably benign Het
Zfp704 C A 3: 9,565,157 R48L probably damaging Het
Other mutations in Flcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Flcn APN 11 59795823 missense probably damaging 1.00
IGL01890:Flcn APN 11 59795170 missense probably benign 0.00
IGL02486:Flcn APN 11 59801043 nonsense probably null
IGL02933:Flcn APN 11 59803757 missense probably damaging 1.00
IGL02935:Flcn APN 11 59795236 missense possibly damaging 0.93
IGL03246:Flcn APN 11 59794110 missense possibly damaging 0.82
Pansy UTSW 11 59792659 missense probably damaging 0.99
R0238:Flcn UTSW 11 59801076 missense probably benign 0.00
R0238:Flcn UTSW 11 59801076 missense probably benign 0.00
R0239:Flcn UTSW 11 59801076 missense probably benign 0.00
R0239:Flcn UTSW 11 59801076 missense probably benign 0.00
R0534:Flcn UTSW 11 59794199 splice site probably benign
R0551:Flcn UTSW 11 59795748 critical splice donor site probably null
R1016:Flcn UTSW 11 59795865 critical splice acceptor site probably null
R1108:Flcn UTSW 11 59801200 missense possibly damaging 0.77
R2350:Flcn UTSW 11 59792659 missense probably damaging 0.99
R4158:Flcn UTSW 11 59801121 missense probably benign 0.26
R4367:Flcn UTSW 11 59803784 missense possibly damaging 0.90
R4371:Flcn UTSW 11 59803784 missense possibly damaging 0.90
R4612:Flcn UTSW 11 59792687 missense probably damaging 1.00
R4689:Flcn UTSW 11 59801044 missense possibly damaging 0.87
R5849:Flcn UTSW 11 59804760 missense probably damaging 0.99
R6007:Flcn UTSW 11 59792622 missense probably benign 0.08
R6433:Flcn UTSW 11 59801082 missense probably damaging 0.97
R6525:Flcn UTSW 11 59794172 missense possibly damaging 0.75
R7027:Flcn UTSW 11 59795806 missense probably damaging 1.00
R7632:Flcn UTSW 11 59795799 nonsense probably null
R8018:Flcn UTSW 11 59794122 missense probably damaging 0.97
X0002:Flcn UTSW 11 59804537 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCCTTCCATGAGTGTCAATGCC -3'
(R):5'- AGCCTCTAGCAGGTCACCAGTATC -3'

Sequencing Primer
(F):5'- GCCTGCCATGTTCACCAG -3'
(R):5'- GGTCACCAGTATCCCTAGAAGG -3'
Posted On2013-05-09