Incidental Mutation 'R4674:Ube4b'
ID348686
Institutional Source Beutler Lab
Gene Symbol Ube4b
Ensembl Gene ENSMUSG00000028960
Gene Nameubiquitination factor E4B
SynonymsUFD2a, 4930551I19Rik, Ufd2p, 4933406G05Rik, UFD2, D4Bwg0973e
MMRRC Submission 041929-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4674 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location149328416-149426749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149331370 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 44 (N44S)
Ref Sequence ENSEMBL: ENSMUSP00000122020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103212] [ENSMUST00000138181] [ENSMUST00000172836] [ENSMUST00000174343]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103212
AA Change: N1089S

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099501
Gene: ENSMUSG00000028960
AA Change: N1089S

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Pfam:Ufd2P_core 462 1083 1.3e-199 PFAM
Ubox 1102 1164 3.94e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000138181
AA Change: N44S

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122020
Gene: ENSMUSG00000028960
AA Change: N44S

DomainStartEndE-ValueType
Pfam:Ufd2P_core 1 39 1.1e-7 PFAM
Ubox 57 119 3.94e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155968
Predicted Effect probably benign
Transcript: ENSMUST00000172836
SMART Domains Protein: ENSMUSP00000134452
Gene: ENSMUSG00000028960

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Pfam:Ufd2P_core 462 983 7.4e-143 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174343
SMART Domains Protein: ENSMUSP00000134556
Gene: ENSMUSG00000028960

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes an additional conjugation factor, E4, which is involved in multiubiquitin chain assembly. This gene is also the strongest candidate in the neuroblastoma tumor suppressor genes. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die by midgestation and exhibit cardiac development defects such as hemorrhage and cardiomyocyte apoptosis. Heterozygous mice exhibit axonal dystrophy in the nucleus gracilis, degeneration of Purkinje cells and gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,810,615 I112T probably benign Het
Acvr1b T C 15: 101,203,058 I367T possibly damaging Het
Akr1b8 G A 6: 34,356,424 probably null Het
Ash1l T C 3: 89,072,476 V2769A possibly damaging Het
Asxl3 A T 18: 22,517,738 D928V probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Ccdc82 A T 9: 13,252,635 H184L probably benign Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Clec1b C A 6: 129,400,134 L47I probably damaging Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Crbn T A 6: 106,790,971 Q173L possibly damaging Het
Cspg4 T C 9: 56,898,205 V2100A probably damaging Het
Cyp46a1 T C 12: 108,358,086 L374P probably damaging Het
Dhx16 T A 17: 35,885,939 V607E probably damaging Het
Dido1 A G 2: 180,687,559 S357P probably damaging Het
Dnah6 T A 6: 73,192,422 I399F probably benign Het
Dock10 T C 1: 80,606,620 E123G possibly damaging Het
Dstyk A G 1: 132,463,390 D843G probably benign Het
Efcab12 C A 6: 115,823,649 V138F probably damaging Het
Egf A G 3: 129,718,040 F493L probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
Exoc6 T C 19: 37,609,082 F644L probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fam184b T A 5: 45,582,888 K319* probably null Het
Fam208b T C 13: 3,573,686 E1406G possibly damaging Het
Flrt2 T A 12: 95,780,688 L600* probably null Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gli2 T C 1: 118,836,029 E1464G probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
H2afy A C 13: 56,083,184 C297G possibly damaging Het
Hdac9 A G 12: 34,373,960 V501A possibly damaging Het
Heca T C 10: 17,915,309 H333R probably benign Het
Hirip3 G A 7: 126,864,662 probably null Het
Igsf8 G A 1: 172,318,912 W51* probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Krt73 T C 15: 101,802,075 N75D probably benign Het
Macf1 T A 4: 123,472,397 Y1292F probably benign Het
Mapk14 A G 17: 28,745,022 probably null Het
Mgat5 T A 1: 127,390,758 V330D probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,444,174 F188L probably damaging Het
Ncoa3 T C 2: 166,059,811 S1035P probably benign Het
Ndn T A 7: 62,348,822 W139R probably damaging Het
Nes T C 3: 87,971,795 V198A possibly damaging Het
Olfr1212 G T 2: 88,958,872 M135I probably damaging Het
Olfr1260 A G 2: 89,977,906 I43V possibly damaging Het
Olfr1465 T A 19: 13,313,814 H157L probably benign Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Pcf11 G A 7: 92,659,777 probably benign Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Pipox T G 11: 77,893,770 Q4P probably benign Het
Pla2g4c C T 7: 13,343,514 T327I probably null Het
Plppr1 C T 4: 49,323,384 R225W probably damaging Het
Pnpla6 T A 8: 3,521,412 V145D probably damaging Het
Pnpla7 T C 2: 25,052,317 Y83H probably damaging Het
Rif1 T A 2: 52,106,942 L970Q probably null Het
Rimklb C A 6: 122,456,283 E303* probably null Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rttn T A 18: 89,011,011 probably null Het
Sf3b3 G A 8: 110,844,505 R10W probably damaging Het
Skint4 G A 4: 112,118,233 C130Y probably damaging Het
Snap91 A G 9: 86,792,017 S593P possibly damaging Het
Ssb A G 2: 69,868,850 Q209R probably benign Het
Stap1 A T 5: 86,081,185 I71L probably benign Het
Syna C A 5: 134,558,355 R580L probably damaging Het
Tacc2 T A 7: 130,624,861 M1111K possibly damaging Het
Tanc2 T C 11: 105,867,480 L689P probably damaging Het
Tdrd5 A C 1: 156,277,435 C463W probably damaging Het
Tet1 A G 10: 62,838,848 F1150L probably damaging Het
Tia1 T A 6: 86,420,400 F118L probably damaging Het
Trav3-1 A T 14: 52,581,003 T45S possibly damaging Het
Uaca A T 9: 60,854,429 Y235F possibly damaging Het
Vmn2r93 T A 17: 18,304,993 H304Q probably benign Het
Wdr18 A G 10: 79,965,235 I161V probably benign Het
Zfp112 A G 7: 24,126,974 H789R probably damaging Het
Zfp873 A G 10: 82,059,980 T182A possibly damaging Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Zufsp A T 10: 33,948,984 D167E possibly damaging Het
Other mutations in Ube4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Ube4b APN 4 149381366 missense probably benign 0.29
IGL00820:Ube4b APN 4 149352921 splice site probably benign
IGL01093:Ube4b APN 4 149330269 missense probably benign 0.01
IGL01154:Ube4b APN 4 149365470 missense probably benign 0.28
IGL01612:Ube4b APN 4 149383818 missense probably damaging 0.98
IGL01800:Ube4b APN 4 149331494 missense probably damaging 1.00
IGL02149:Ube4b APN 4 149398684 missense possibly damaging 0.88
IGL02472:Ube4b APN 4 149387079 critical splice donor site probably null
IGL02839:Ube4b APN 4 149368399 missense probably damaging 0.98
IGL03027:Ube4b APN 4 149381277 missense probably damaging 1.00
R0143:Ube4b UTSW 4 149355457 missense possibly damaging 0.61
R0164:Ube4b UTSW 4 149360324 missense probably damaging 0.98
R0164:Ube4b UTSW 4 149360324 missense probably damaging 0.98
R0206:Ube4b UTSW 4 149398637 missense probably benign 0.38
R0591:Ube4b UTSW 4 149357577 intron probably benign
R1366:Ube4b UTSW 4 149335149 missense probably damaging 0.98
R1452:Ube4b UTSW 4 149371169 missense probably damaging 1.00
R1513:Ube4b UTSW 4 149351578 missense probably benign 0.17
R1668:Ube4b UTSW 4 149361294 missense probably benign 0.02
R1874:Ube4b UTSW 4 149347971 missense probably damaging 1.00
R2002:Ube4b UTSW 4 149383797 missense probably benign 0.16
R2050:Ube4b UTSW 4 149344612 missense probably damaging 1.00
R2109:Ube4b UTSW 4 149372841 missense probably benign 0.00
R2281:Ube4b UTSW 4 149344572 missense probably damaging 1.00
R3547:Ube4b UTSW 4 149335116 missense probably damaging 1.00
R3881:Ube4b UTSW 4 149365404 intron probably null
R4378:Ube4b UTSW 4 149383798 missense probably damaging 1.00
R4563:Ube4b UTSW 4 149359165 intron probably benign
R4716:Ube4b UTSW 4 149344612 missense probably damaging 1.00
R5026:Ube4b UTSW 4 149360565 missense probably damaging 1.00
R5125:Ube4b UTSW 4 149342992 missense probably damaging 1.00
R5178:Ube4b UTSW 4 149342992 missense probably damaging 1.00
R5182:Ube4b UTSW 4 149381242 missense probably null 0.08
R5229:Ube4b UTSW 4 149387178 missense probably damaging 1.00
R5303:Ube4b UTSW 4 149383803 missense probably damaging 0.98
R5346:Ube4b UTSW 4 149337424 missense possibly damaging 0.91
R5780:Ube4b UTSW 4 149331364 missense probably benign 0.00
R5813:Ube4b UTSW 4 149337468 missense probably damaging 1.00
R5842:Ube4b UTSW 4 149331430 missense probably benign 0.01
R5994:Ube4b UTSW 4 149372932 missense probably damaging 0.97
R6020:Ube4b UTSW 4 149368311 missense probably benign 0.17
R6125:Ube4b UTSW 4 149398746 missense probably benign 0.13
R6272:Ube4b UTSW 4 149387133 missense probably damaging 1.00
R6333:Ube4b UTSW 4 149348037 missense probably damaging 1.00
R6426:Ube4b UTSW 4 149425996 unclassified probably benign
R7203:Ube4b UTSW 4 149398610 missense probably benign 0.30
R7341:Ube4b UTSW 4 149343001 missense probably damaging 1.00
R7672:Ube4b UTSW 4 149387204 missense probably benign 0.10
R7713:Ube4b UTSW 4 149398781 missense possibly damaging 0.53
Z1088:Ube4b UTSW 4 149335125 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCAGCTATAGCATCAGACAATCAAG -3'
(R):5'- GCACTTGGCCGTTTCTGATG -3'

Sequencing Primer
(F):5'- GAATTCGTGGTCCCCAGTTAACAG -3'
(R):5'- CGTTTCTGATGTGTTTTCTTCTCAAG -3'
Posted On2015-10-08