Incidental Mutation 'R0265:Nos2'
ID 34870
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms iNOS, Nos-2, Nos2a, NOS-II
MMRRC Submission 038491-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0265 (G1)
Quality Score 138
Status Validated
Chromosome 11
Chromosomal Location 78920787-78960254 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78937602 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 249 (H249L)
Ref Sequence ENSEMBL: ENSMUSP00000018610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
PDB Structure MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DOMAIN (DELTA 114) (N-[(1,3-BENZODIOXOL-5-YL)METHYL]-1-[2-(1H-IMIDAZOL-1-YL)PYRIMIDIN-4-YL]-4-(METHOXYCARBONYL)-PIPERAZINE-2-ACETAMIDE COMPLEX [X-RAY DIFFRACTION]
MURINE INOSOXY DIMER WITH ISOTHIOUREA BOUND IN THE ACTIVE SITE [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND 4-AMINO TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND DIHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457F Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457A Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
inducible nitric oxide synthase with Chlorzoxazone bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 7-nitroindazole bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 6-nitroindazole bound [X-RAY DIFFRACTION]
>> 40 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000018610
AA Change: H249L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: H249L

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209121
Predicted Effect possibly damaging
Transcript: ENSMUST00000214397
AA Change: H136L

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.3304 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.6%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T G 14: 8,431,667 Y655S probably damaging Het
9330182L06Rik T C 5: 9,434,681 L486P probably damaging Het
Abca14 A G 7: 120,223,627 I321V probably benign Het
Adcy7 A G 8: 88,324,763 D837G probably damaging Het
Aldh1a1 T A 19: 20,640,076 Y457* probably null Het
Alox5 T C 6: 116,420,362 Y287C probably benign Het
Ano8 T C 8: 71,480,524 probably benign Het
Ap3b1 A G 13: 94,493,681 K815E unknown Het
Atp11a A T 8: 12,856,930 probably benign Het
Atp6v0a1 A T 11: 101,048,515 D702V possibly damaging Het
Cacna1b T A 2: 24,761,844 N108Y probably damaging Het
Ccdc57 G C 11: 120,921,811 A39G probably benign Het
Cdhr1 A T 14: 37,081,376 V581D probably benign Het
Cyp2b23 A G 7: 26,672,879 probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Ddit4l C T 3: 137,624,287 probably benign Het
Dnah8 A T 17: 30,690,271 I1024F probably benign Het
Edc3 T A 9: 57,727,338 F213I probably damaging Het
Edrf1 G A 7: 133,657,045 D717N probably damaging Het
Efna5 G A 17: 62,651,073 P63S probably damaging Het
Entpd3 A G 9: 120,558,481 Y248C probably damaging Het
Flcn G A 11: 59,795,809 Q373* probably null Het
Fry T C 5: 150,434,776 V1908A probably damaging Het
Gabrg3 A T 7: 57,381,617 Y58* probably null Het
Gabrp A T 11: 33,552,614 Y417N probably damaging Het
Golga2 C A 2: 32,304,952 probably null Het
Grip2 C A 6: 91,773,792 probably null Het
Gsx2 A G 5: 75,077,068 Y227C probably damaging Het
Hif3a T C 7: 17,035,868 *665W probably null Het
Hist1h2aa T C 13: 23,934,649 V63A probably benign Het
Hsd3b1 C A 3: 98,852,773 V301L probably damaging Het
Ifitm5 T C 7: 140,950,008 probably benign Het
Inpp4a A T 1: 37,378,986 D498V probably damaging Het
Itga1 A T 13: 114,992,459 D554E probably benign Het
Itk G A 11: 46,389,458 probably benign Het
Kdm3b T A 18: 34,795,663 probably benign Het
Klhl6 A G 16: 19,948,234 V470A probably benign Het
Lamb3 T A 1: 193,320,531 W95R probably damaging Het
Lbhd2 T A 12: 111,410,242 I41N probably damaging Het
Lrp4 A T 2: 91,490,670 S1014C probably damaging Het
Ltbp2 C T 12: 84,785,969 probably null Het
Map3k19 A G 1: 127,822,182 I1144T possibly damaging Het
Mfsd10 T C 5: 34,635,163 probably benign Het
Mocos A G 18: 24,666,276 D189G probably benign Het
Mvb12a T A 8: 71,547,010 F224L probably damaging Het
Myo15 A T 11: 60,514,897 probably null Het
Notum A G 11: 120,658,334 M184T probably benign Het
Nvl C A 1: 181,134,830 D192Y probably damaging Het
Olfr1024 T A 2: 85,904,247 N269I probably benign Het
Olfr1065 C A 2: 86,445,959 V8L probably benign Het
Olfr1308 T C 2: 111,960,494 Y193C probably damaging Het
Olfr204 A T 16: 59,315,071 F112Y probably damaging Het
Olfr218 A G 1: 173,203,917 K187R probably benign Het
Osgin1 A G 8: 119,445,657 I397V possibly damaging Het
Otulin A G 15: 27,616,424 V123A probably damaging Het
P4ha1 A G 10: 59,348,259 Y181C probably damaging Het
Pcdhgc5 A T 18: 37,821,350 D559V probably damaging Het
Phf2 T C 13: 48,828,794 N151S unknown Het
Plxnc1 C A 10: 94,813,129 G1263C probably benign Het
Rad51ap1 A G 6: 126,924,197 *338Q probably null Het
Raver1 A G 9: 21,075,659 S676P probably benign Het
Rfx8 T C 1: 39,688,577 E196G possibly damaging Het
Rreb1 A T 13: 37,916,155 K187* probably null Het
Rxfp1 T C 3: 79,667,654 T217A probably benign Het
Rxra T C 2: 27,752,430 L305P probably damaging Het
Sardh T C 2: 27,227,066 probably benign Het
Skor2 A T 18: 76,876,598 E952D probably damaging Het
Slc22a29 A T 19: 8,169,970 S343T probably benign Het
Sorbs2 T C 8: 45,785,337 probably benign Het
Supt7l C T 5: 31,515,918 V329I probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 T C 6: 7,559,165 probably benign Het
Tcn2 A T 11: 3,922,044 V361D probably damaging Het
Tm2d3 G A 7: 65,697,834 A170T possibly damaging Het
Tnks G A 8: 34,839,970 R1142* probably null Het
Ttll7 C A 3: 146,944,160 Y648* probably null Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Upf2 G A 2: 6,027,204 probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Washc5 A G 15: 59,338,960 I1013T probably benign Het
Wdr60 T C 12: 116,257,406 probably benign Het
Zfp704 C A 3: 9,565,157 R48L probably damaging Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78957452 missense probably damaging 0.96
IGL01503:Nos2 APN 11 78945863 splice site probably benign
IGL01789:Nos2 APN 11 78944657 splice site probably benign
IGL02797:Nos2 APN 11 78940344 missense probably damaging 1.00
IGL02968:Nos2 APN 11 78937637 missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78959748 missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78945727 missense probably damaging 1.00
R0441:Nos2 UTSW 11 78928583 missense probably benign 0.10
R0504:Nos2 UTSW 11 78940077 missense probably damaging 1.00
R0570:Nos2 UTSW 11 78935361 missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78952803 missense probably benign 0.00
R1538:Nos2 UTSW 11 78956570 missense probably benign 0.00
R3414:Nos2 UTSW 11 78957588 missense probably benign 0.14
R3418:Nos2 UTSW 11 78959695 missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78929776 missense probably benign 0.01
R4492:Nos2 UTSW 11 78950095 missense probably benign
R4632:Nos2 UTSW 11 78957591 missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78928630 missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78922314 missense probably benign
R5214:Nos2 UTSW 11 78955441 missense probably damaging 1.00
R5377:Nos2 UTSW 11 78957491 missense probably benign 0.00
R5777:Nos2 UTSW 11 78940152 missense probably null 1.00
R5834:Nos2 UTSW 11 78928579 missense probably benign 0.01
R5930:Nos2 UTSW 11 78937915 missense probably damaging 1.00
R6511:Nos2 UTSW 11 78955464 splice site probably null
R6706:Nos2 UTSW 11 78944723 missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78952954 missense probably damaging 0.99
R6762:Nos2 UTSW 11 78959748 missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78945266 missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78957506 missense probably benign 0.02
R6917:Nos2 UTSW 11 78951227 missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78928579 missense probably benign 0.02
R7286:Nos2 UTSW 11 78929854 missense probably damaging 1.00
R7367:Nos2 UTSW 11 78950090 missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78936471 nonsense probably null
R7411:Nos2 UTSW 11 78944855 critical splice donor site probably null
R7469:Nos2 UTSW 11 78952971 missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78922366 nonsense probably null
R8694:Nos2 UTSW 11 78945689 missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78955464 splice site probably null
R8872:Nos2 UTSW 11 78949123 missense probably damaging 0.99
R8952:Nos2 UTSW 11 78945263 missense probably benign 0.00
R9433:Nos2 UTSW 11 78959664 missense probably damaging 1.00
R9580:Nos2 UTSW 11 78937631 missense probably benign 0.01
R9612:Nos2 UTSW 11 78949158 missense probably damaging 1.00
R9727:Nos2 UTSW 11 78952999 missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78931646 missense probably damaging 0.96
X0063:Nos2 UTSW 11 78922367 missense probably benign 0.01
Z1177:Nos2 UTSW 11 78931672 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGAGACCCTAGAATGCAGCTCC -3'
(R):5'- TTGCAAGACCAGAGGCAGCACATC -3'

Sequencing Primer
(F):5'- tgtgtgtgtgtAAGGGACATGAG -3'
(R):5'- CTAGGTCGATGCACAACTGAG -3'
Posted On 2013-05-09