Incidental Mutation 'R4674:Rpl13a'
ID348702
Institutional Source Beutler Lab
Gene Symbol Rpl13a
Ensembl Gene ENSMUSG00000074129
Gene Nameribosomal protein L13A
SynonymsTstap198-7, tum-transplantation antigen P198, tum-antigen, 1810026N22Rik
MMRRC Submission 041929-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R4674 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45125558-45128761 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 45126818 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003521] [ENSMUST00000146760] [ENSMUST00000150350] [ENSMUST00000209212] [ENSMUST00000209238] [ENSMUST00000209467] [ENSMUST00000209711] [ENSMUST00000209812] [ENSMUST00000209815] [ENSMUST00000209927] [ENSMUST00000210191] [ENSMUST00000210818] [ENSMUST00000210918] [ENSMUST00000210931] [ENSMUST00000210967] [ENSMUST00000211037] [ENSMUST00000211429] [ENSMUST00000211725]
Predicted Effect probably benign
Transcript: ENSMUST00000003521
SMART Domains Protein: ENSMUSP00000003521
Gene: ENSMUSG00000003429

DomainStartEndE-ValueType
Pfam:Ribosomal_S17_N 5 73 1.9e-40 PFAM
Pfam:Ribosomal_S17 75 144 1.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125936
AA Change: M21K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131697
AA Change: D150E
Predicted Effect probably benign
Transcript: ENSMUST00000146760
SMART Domains Protein: ENSMUSP00000123506
Gene: ENSMUSG00000110206

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Flt3_lig 28 162 1.9e-94 PFAM
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150350
SMART Domains Protein: ENSMUSP00000115722
Gene: ENSMUSG00000074129

DomainStartEndE-ValueType
Pfam:Ribosomal_L13 6 122 7e-27 PFAM
low complexity region 169 180 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198528
Predicted Effect probably benign
Transcript: ENSMUST00000209212
Predicted Effect probably benign
Transcript: ENSMUST00000209238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209340
Predicted Effect probably benign
Transcript: ENSMUST00000209467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209626
Predicted Effect probably benign
Transcript: ENSMUST00000209711
Predicted Effect probably benign
Transcript: ENSMUST00000209812
Predicted Effect unknown
Transcript: ENSMUST00000209815
AA Change: M85K
Predicted Effect probably benign
Transcript: ENSMUST00000209838
Predicted Effect probably benign
Transcript: ENSMUST00000209927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210175
Predicted Effect probably benign
Transcript: ENSMUST00000210191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210792
Predicted Effect probably benign
Transcript: ENSMUST00000210818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210832
Predicted Effect probably benign
Transcript: ENSMUST00000210918
Predicted Effect probably benign
Transcript: ENSMUST00000210931
Predicted Effect probably benign
Transcript: ENSMUST00000210967
Predicted Effect probably benign
Transcript: ENSMUST00000211037
Predicted Effect probably benign
Transcript: ENSMUST00000211429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211583
Predicted Effect probably benign
Transcript: ENSMUST00000211725
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L13P family of ribosomal proteins that is a component of the 60S subunit. The encoded protein also plays a role in the repression of inflammatory genes as a component of the IFN-gamma-activated inhibitor of translation (GAIT) complex. This gene is co-transcribed with the small nucleolar RNA genes U32, U33, U34, and U35, which are located in the second, fourth, fifth, and sixth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes lacking snoRNAs encoded by introns of this gene show altered mitochondrial metabolism, lower reactive oxygen species tone, enhanced glucose-stimulated insulin secretion and glucose tolerance, reduced oxidative stress responses in pancreatic islets, and resistance to diabetogenic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,810,615 I112T probably benign Het
Acvr1b T C 15: 101,203,058 I367T possibly damaging Het
Akr1b8 G A 6: 34,356,424 probably null Het
Ash1l T C 3: 89,072,476 V2769A possibly damaging Het
Asxl3 A T 18: 22,517,738 D928V probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Ccdc82 A T 9: 13,252,635 H184L probably benign Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Clec1b C A 6: 129,400,134 L47I probably damaging Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Crbn T A 6: 106,790,971 Q173L possibly damaging Het
Cspg4 T C 9: 56,898,205 V2100A probably damaging Het
Cyp46a1 T C 12: 108,358,086 L374P probably damaging Het
Dhx16 T A 17: 35,885,939 V607E probably damaging Het
Dido1 A G 2: 180,687,559 S357P probably damaging Het
Dnah6 T A 6: 73,192,422 I399F probably benign Het
Dock10 T C 1: 80,606,620 E123G possibly damaging Het
Dstyk A G 1: 132,463,390 D843G probably benign Het
Efcab12 C A 6: 115,823,649 V138F probably damaging Het
Egf A G 3: 129,718,040 F493L probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
Exoc6 T C 19: 37,609,082 F644L probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fam184b T A 5: 45,582,888 K319* probably null Het
Fam208b T C 13: 3,573,686 E1406G possibly damaging Het
Flrt2 T A 12: 95,780,688 L600* probably null Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gli2 T C 1: 118,836,029 E1464G probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
H2afy A C 13: 56,083,184 C297G possibly damaging Het
Hdac9 A G 12: 34,373,960 V501A possibly damaging Het
Heca T C 10: 17,915,309 H333R probably benign Het
Hirip3 G A 7: 126,864,662 probably null Het
Igsf8 G A 1: 172,318,912 W51* probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Krt73 T C 15: 101,802,075 N75D probably benign Het
Macf1 T A 4: 123,472,397 Y1292F probably benign Het
Mapk14 A G 17: 28,745,022 probably null Het
Mgat5 T A 1: 127,390,758 V330D probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,444,174 F188L probably damaging Het
Ncoa3 T C 2: 166,059,811 S1035P probably benign Het
Ndn T A 7: 62,348,822 W139R probably damaging Het
Nes T C 3: 87,971,795 V198A possibly damaging Het
Olfr1212 G T 2: 88,958,872 M135I probably damaging Het
Olfr1260 A G 2: 89,977,906 I43V possibly damaging Het
Olfr1465 T A 19: 13,313,814 H157L probably benign Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Pcf11 G A 7: 92,659,777 probably benign Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Pipox T G 11: 77,893,770 Q4P probably benign Het
Pla2g4c C T 7: 13,343,514 T327I probably null Het
Plppr1 C T 4: 49,323,384 R225W probably damaging Het
Pnpla6 T A 8: 3,521,412 V145D probably damaging Het
Pnpla7 T C 2: 25,052,317 Y83H probably damaging Het
Rif1 T A 2: 52,106,942 L970Q probably null Het
Rimklb C A 6: 122,456,283 E303* probably null Het
Rttn T A 18: 89,011,011 probably null Het
Sf3b3 G A 8: 110,844,505 R10W probably damaging Het
Skint4 G A 4: 112,118,233 C130Y probably damaging Het
Snap91 A G 9: 86,792,017 S593P possibly damaging Het
Ssb A G 2: 69,868,850 Q209R probably benign Het
Stap1 A T 5: 86,081,185 I71L probably benign Het
Syna C A 5: 134,558,355 R580L probably damaging Het
Tacc2 T A 7: 130,624,861 M1111K possibly damaging Het
Tanc2 T C 11: 105,867,480 L689P probably damaging Het
Tdrd5 A C 1: 156,277,435 C463W probably damaging Het
Tet1 A G 10: 62,838,848 F1150L probably damaging Het
Tia1 T A 6: 86,420,400 F118L probably damaging Het
Trav3-1 A T 14: 52,581,003 T45S possibly damaging Het
Uaca A T 9: 60,854,429 Y235F possibly damaging Het
Ube4b T C 4: 149,331,370 N44S possibly damaging Het
Vmn2r93 T A 17: 18,304,993 H304Q probably benign Het
Wdr18 A G 10: 79,965,235 I161V probably benign Het
Zfp112 A G 7: 24,126,974 H789R probably damaging Het
Zfp873 A G 10: 82,059,980 T182A possibly damaging Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Zufsp A T 10: 33,948,984 D167E possibly damaging Het
Other mutations in Rpl13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Rpl13a APN 7 45127071 unclassified probably null
R1972:Rpl13a UTSW 7 45125995 nonsense probably null
R1973:Rpl13a UTSW 7 45125995 nonsense probably null
R4501:Rpl13a UTSW 7 45126140 missense probably benign 0.13
R4675:Rpl13a UTSW 7 45126818 unclassified probably benign
R5151:Rpl13a UTSW 7 45125961 missense probably benign 0.35
R7565:Rpl13a UTSW 7 45127042 missense probably benign 0.05
R7667:Rpl13a UTSW 7 45126173 missense probably damaging 0.96
R7699:Rpl13a UTSW 7 45127236 missense probably benign 0.12
R7700:Rpl13a UTSW 7 45127236 missense probably benign 0.12
Z1088:Rpl13a UTSW 7 45127513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCAGTGGGGTTTTCATG -3'
(R):5'- ATTTTCTGGCGCACTGTGC -3'

Sequencing Primer
(F):5'- GGGTTTTCATGAGGCTCAAACAATG -3'
(R):5'- GCACTGTGCGAGGTGAG -3'
Posted On2015-10-08