Incidental Mutation 'R4674:Pnpla6'
ID348711
Institutional Source Beutler Lab
Gene Symbol Pnpla6
Ensembl Gene ENSMUSG00000004565
Gene Namepatatin-like phospholipase domain containing 6
SynonymsNte, Swiss-cheese, MSws
MMRRC Submission 041929-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4674 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location3515384-3544267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3521412 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 145 (V145D)
Ref Sequence ENSEMBL: ENSMUSP00000147227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000111070] [ENSMUST00000207146] [ENSMUST00000207424] [ENSMUST00000207941] [ENSMUST00000208002] [ENSMUST00000208310] [ENSMUST00000208762]
Predicted Effect probably damaging
Transcript: ENSMUST00000004681
AA Change: V145D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565
AA Change: V145D

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111070
AA Change: V145D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565
AA Change: V145D

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207146
Predicted Effect probably damaging
Transcript: ENSMUST00000207424
AA Change: V145D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207430
Predicted Effect probably damaging
Transcript: ENSMUST00000207941
AA Change: V177D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000208002
AA Change: V167D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208006
Predicted Effect probably benign
Transcript: ENSMUST00000208310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208315
Predicted Effect probably benign
Transcript: ENSMUST00000208762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208851
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during early gestation. Conditional inactivation in the central nervous system leads to neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,810,615 I112T probably benign Het
Acvr1b T C 15: 101,203,058 I367T possibly damaging Het
Akr1b8 G A 6: 34,356,424 probably null Het
Ash1l T C 3: 89,072,476 V2769A possibly damaging Het
Asxl3 A T 18: 22,517,738 D928V probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Ccdc82 A T 9: 13,252,635 H184L probably benign Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Clec1b C A 6: 129,400,134 L47I probably damaging Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Crbn T A 6: 106,790,971 Q173L possibly damaging Het
Cspg4 T C 9: 56,898,205 V2100A probably damaging Het
Cyp46a1 T C 12: 108,358,086 L374P probably damaging Het
Dhx16 T A 17: 35,885,939 V607E probably damaging Het
Dido1 A G 2: 180,687,559 S357P probably damaging Het
Dnah6 T A 6: 73,192,422 I399F probably benign Het
Dock10 T C 1: 80,606,620 E123G possibly damaging Het
Dstyk A G 1: 132,463,390 D843G probably benign Het
Efcab12 C A 6: 115,823,649 V138F probably damaging Het
Egf A G 3: 129,718,040 F493L probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
Exoc6 T C 19: 37,609,082 F644L probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fam184b T A 5: 45,582,888 K319* probably null Het
Fam208b T C 13: 3,573,686 E1406G possibly damaging Het
Flrt2 T A 12: 95,780,688 L600* probably null Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gli2 T C 1: 118,836,029 E1464G probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
H2afy A C 13: 56,083,184 C297G possibly damaging Het
Hdac9 A G 12: 34,373,960 V501A possibly damaging Het
Heca T C 10: 17,915,309 H333R probably benign Het
Hirip3 G A 7: 126,864,662 probably null Het
Igsf8 G A 1: 172,318,912 W51* probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Krt73 T C 15: 101,802,075 N75D probably benign Het
Macf1 T A 4: 123,472,397 Y1292F probably benign Het
Mapk14 A G 17: 28,745,022 probably null Het
Mgat5 T A 1: 127,390,758 V330D probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,444,174 F188L probably damaging Het
Ncoa3 T C 2: 166,059,811 S1035P probably benign Het
Ndn T A 7: 62,348,822 W139R probably damaging Het
Nes T C 3: 87,971,795 V198A possibly damaging Het
Olfr1212 G T 2: 88,958,872 M135I probably damaging Het
Olfr1260 A G 2: 89,977,906 I43V possibly damaging Het
Olfr1465 T A 19: 13,313,814 H157L probably benign Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Pcf11 G A 7: 92,659,777 probably benign Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Pipox T G 11: 77,893,770 Q4P probably benign Het
Pla2g4c C T 7: 13,343,514 T327I probably null Het
Plppr1 C T 4: 49,323,384 R225W probably damaging Het
Pnpla7 T C 2: 25,052,317 Y83H probably damaging Het
Rif1 T A 2: 52,106,942 L970Q probably null Het
Rimklb C A 6: 122,456,283 E303* probably null Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rttn T A 18: 89,011,011 probably null Het
Sf3b3 G A 8: 110,844,505 R10W probably damaging Het
Skint4 G A 4: 112,118,233 C130Y probably damaging Het
Snap91 A G 9: 86,792,017 S593P possibly damaging Het
Ssb A G 2: 69,868,850 Q209R probably benign Het
Stap1 A T 5: 86,081,185 I71L probably benign Het
Syna C A 5: 134,558,355 R580L probably damaging Het
Tacc2 T A 7: 130,624,861 M1111K possibly damaging Het
Tanc2 T C 11: 105,867,480 L689P probably damaging Het
Tdrd5 A C 1: 156,277,435 C463W probably damaging Het
Tet1 A G 10: 62,838,848 F1150L probably damaging Het
Tia1 T A 6: 86,420,400 F118L probably damaging Het
Trav3-1 A T 14: 52,581,003 T45S possibly damaging Het
Uaca A T 9: 60,854,429 Y235F possibly damaging Het
Ube4b T C 4: 149,331,370 N44S possibly damaging Het
Vmn2r93 T A 17: 18,304,993 H304Q probably benign Het
Wdr18 A G 10: 79,965,235 I161V probably benign Het
Zfp112 A G 7: 24,126,974 H789R probably damaging Het
Zfp873 A G 10: 82,059,980 T182A possibly damaging Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Zufsp A T 10: 33,948,984 D167E possibly damaging Het
Other mutations in Pnpla6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pnpla6 APN 8 3523808 missense probably damaging 1.00
IGL00820:Pnpla6 APN 8 3532358 missense possibly damaging 0.95
IGL00839:Pnpla6 APN 8 3542299 missense probably benign 0.05
IGL01732:Pnpla6 APN 8 3522616 missense probably damaging 0.99
IGL01973:Pnpla6 APN 8 3517619 missense probably damaging 1.00
IGL02267:Pnpla6 APN 8 3517327 missense probably benign 0.00
IGL03246:Pnpla6 APN 8 3531530 missense probably benign 0.01
IGL03286:Pnpla6 APN 8 3531473 missense probably damaging 0.99
I0000:Pnpla6 UTSW 8 3542322 missense probably benign
R0141:Pnpla6 UTSW 8 3532117 critical splice donor site probably null
R0180:Pnpla6 UTSW 8 3524250 critical splice acceptor site probably null
R0377:Pnpla6 UTSW 8 3541501 missense probably damaging 1.00
R0563:Pnpla6 UTSW 8 3523333 missense possibly damaging 0.51
R0660:Pnpla6 UTSW 8 3522269 unclassified probably benign
R0786:Pnpla6 UTSW 8 3523317 missense probably benign
R0827:Pnpla6 UTSW 8 3517618 missense possibly damaging 0.71
R0882:Pnpla6 UTSW 8 3517081 missense probably damaging 1.00
R1512:Pnpla6 UTSW 8 3535459 splice site probably benign
R1552:Pnpla6 UTSW 8 3522403 missense probably damaging 1.00
R1609:Pnpla6 UTSW 8 3517135 missense probably damaging 1.00
R1770:Pnpla6 UTSW 8 3534634 missense possibly damaging 0.94
R1779:Pnpla6 UTSW 8 3541404 missense probably damaging 1.00
R1987:Pnpla6 UTSW 8 3542370 missense probably benign 0.00
R3079:Pnpla6 UTSW 8 3541512 missense probably benign 0.25
R3125:Pnpla6 UTSW 8 3534670 missense probably null 1.00
R4171:Pnpla6 UTSW 8 3543997 missense probably benign 0.09
R4281:Pnpla6 UTSW 8 3521513 missense probably damaging 1.00
R4776:Pnpla6 UTSW 8 3523818 missense probably benign 0.01
R4779:Pnpla6 UTSW 8 3522838 missense probably benign 0.00
R5114:Pnpla6 UTSW 8 3522613 missense probably damaging 0.98
R5459:Pnpla6 UTSW 8 3535829 missense probably benign 0.01
R5510:Pnpla6 UTSW 8 3521397 missense probably damaging 0.99
R5538:Pnpla6 UTSW 8 3531508 missense probably benign 0.01
R5664:Pnpla6 UTSW 8 3537478 missense probably damaging 0.98
R6063:Pnpla6 UTSW 8 3524156 missense probably benign 0.21
R6314:Pnpla6 UTSW 8 3521572 missense probably benign 0.39
R6321:Pnpla6 UTSW 8 3544015 missense probably benign
R6454:Pnpla6 UTSW 8 3537986 missense probably damaging 0.99
R6477:Pnpla6 UTSW 8 3536627 missense probably benign 0.00
R6524:Pnpla6 UTSW 8 3534519 splice site probably null
R6809:Pnpla6 UTSW 8 3534611 missense possibly damaging 0.72
R6975:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7293:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7389:Pnpla6 UTSW 8 3543981 nonsense probably null
R7426:Pnpla6 UTSW 8 3516540 utr 5 prime probably null
R7520:Pnpla6 UTSW 8 3537508 missense probably damaging 1.00
R7666:Pnpla6 UTSW 8 3541591 missense probably benign 0.01
R7733:Pnpla6 UTSW 8 3522660 missense probably benign 0.01
R7743:Pnpla6 UTSW 8 3536594 missense possibly damaging 0.77
R7744:Pnpla6 UTSW 8 3531677 missense probably benign 0.38
X0018:Pnpla6 UTSW 8 3517337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGATTAAATGGGTGTCTTAGTTC -3'
(R):5'- ATGCTGGCATCTGGTTGACC -3'

Sequencing Primer
(F):5'- TAAGGCCATCTGCATGTCAG -3'
(R):5'- TTGACCGGGCCGAAAAAC -3'
Posted On2015-10-08