Incidental Mutation 'R4674:Heca'
ID348718
Institutional Source Beutler Lab
Gene Symbol Heca
Ensembl Gene ENSMUSG00000039879
Gene Namehdc homolog, cell cycle regulator
SynonymsLOC380629
MMRRC Submission 041929-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R4674 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location17868612-17948067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17915309 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 333 (H333R)
Ref Sequence ENSEMBL: ENSMUSP00000040707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037879]
Predicted Effect probably benign
Transcript: ENSMUST00000037879
AA Change: H333R

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040707
Gene: ENSMUSG00000039879
AA Change: H333R

DomainStartEndE-ValueType
SCOP:d1gkub1 29 61 8e-3 SMART
Pfam:HECA 94 192 2.8e-42 PFAM
Pfam:Headcase 335 535 2.8e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218758
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila headcase protein, a highly basic, cytoplasmic protein that regulates the re-entry of imaginal cells into the mitotic cycle during adult morphogenesis. In Drosophila, the encoded protein also inhibits terminal branching of neighboring cells during tracheal development. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,810,615 I112T probably benign Het
Acvr1b T C 15: 101,203,058 I367T possibly damaging Het
Akr1b8 G A 6: 34,356,424 probably null Het
Ash1l T C 3: 89,072,476 V2769A possibly damaging Het
Asxl3 A T 18: 22,517,738 D928V probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Ccdc82 A T 9: 13,252,635 H184L probably benign Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Clec1b C A 6: 129,400,134 L47I probably damaging Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Crbn T A 6: 106,790,971 Q173L possibly damaging Het
Cspg4 T C 9: 56,898,205 V2100A probably damaging Het
Cyp46a1 T C 12: 108,358,086 L374P probably damaging Het
Dhx16 T A 17: 35,885,939 V607E probably damaging Het
Dido1 A G 2: 180,687,559 S357P probably damaging Het
Dnah6 T A 6: 73,192,422 I399F probably benign Het
Dock10 T C 1: 80,606,620 E123G possibly damaging Het
Dstyk A G 1: 132,463,390 D843G probably benign Het
Efcab12 C A 6: 115,823,649 V138F probably damaging Het
Egf A G 3: 129,718,040 F493L probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
Exoc6 T C 19: 37,609,082 F644L probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fam184b T A 5: 45,582,888 K319* probably null Het
Fam208b T C 13: 3,573,686 E1406G possibly damaging Het
Flrt2 T A 12: 95,780,688 L600* probably null Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gli2 T C 1: 118,836,029 E1464G probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
H2afy A C 13: 56,083,184 C297G possibly damaging Het
Hdac9 A G 12: 34,373,960 V501A possibly damaging Het
Hirip3 G A 7: 126,864,662 probably null Het
Igsf8 G A 1: 172,318,912 W51* probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Krt73 T C 15: 101,802,075 N75D probably benign Het
Macf1 T A 4: 123,472,397 Y1292F probably benign Het
Mapk14 A G 17: 28,745,022 probably null Het
Mgat5 T A 1: 127,390,758 V330D probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,444,174 F188L probably damaging Het
Ncoa3 T C 2: 166,059,811 S1035P probably benign Het
Ndn T A 7: 62,348,822 W139R probably damaging Het
Nes T C 3: 87,971,795 V198A possibly damaging Het
Olfr1212 G T 2: 88,958,872 M135I probably damaging Het
Olfr1260 A G 2: 89,977,906 I43V possibly damaging Het
Olfr1465 T A 19: 13,313,814 H157L probably benign Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Pcf11 G A 7: 92,659,777 probably benign Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Pipox T G 11: 77,893,770 Q4P probably benign Het
Pla2g4c C T 7: 13,343,514 T327I probably null Het
Plppr1 C T 4: 49,323,384 R225W probably damaging Het
Pnpla6 T A 8: 3,521,412 V145D probably damaging Het
Pnpla7 T C 2: 25,052,317 Y83H probably damaging Het
Rif1 T A 2: 52,106,942 L970Q probably null Het
Rimklb C A 6: 122,456,283 E303* probably null Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rttn T A 18: 89,011,011 probably null Het
Sf3b3 G A 8: 110,844,505 R10W probably damaging Het
Skint4 G A 4: 112,118,233 C130Y probably damaging Het
Snap91 A G 9: 86,792,017 S593P possibly damaging Het
Ssb A G 2: 69,868,850 Q209R probably benign Het
Stap1 A T 5: 86,081,185 I71L probably benign Het
Syna C A 5: 134,558,355 R580L probably damaging Het
Tacc2 T A 7: 130,624,861 M1111K possibly damaging Het
Tanc2 T C 11: 105,867,480 L689P probably damaging Het
Tdrd5 A C 1: 156,277,435 C463W probably damaging Het
Tet1 A G 10: 62,838,848 F1150L probably damaging Het
Tia1 T A 6: 86,420,400 F118L probably damaging Het
Trav3-1 A T 14: 52,581,003 T45S possibly damaging Het
Uaca A T 9: 60,854,429 Y235F possibly damaging Het
Ube4b T C 4: 149,331,370 N44S possibly damaging Het
Vmn2r93 T A 17: 18,304,993 H304Q probably benign Het
Wdr18 A G 10: 79,965,235 I161V probably benign Het
Zfp112 A G 7: 24,126,974 H789R probably damaging Het
Zfp873 A G 10: 82,059,980 T182A possibly damaging Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Zufsp A T 10: 33,948,984 D167E possibly damaging Het
Other mutations in Heca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Heca APN 10 17915967 missense probably damaging 1.00
IGL01971:Heca APN 10 17915414 missense probably damaging 1.00
E0374:Heca UTSW 10 17908176 missense probably damaging 1.00
R0089:Heca UTSW 10 17908100 missense probably damaging 0.99
R0218:Heca UTSW 10 17915715 missense probably benign 0.22
R0608:Heca UTSW 10 17915291 missense possibly damaging 0.86
R4131:Heca UTSW 10 17902239 missense probably damaging 1.00
R4132:Heca UTSW 10 17902239 missense probably damaging 1.00
R4675:Heca UTSW 10 17915309 missense probably benign 0.30
R4736:Heca UTSW 10 17915187 nonsense probably null
R4789:Heca UTSW 10 17908147 nonsense probably null
R4819:Heca UTSW 10 17908072 missense probably damaging 1.00
R5372:Heca UTSW 10 17915139 missense probably damaging 1.00
R5412:Heca UTSW 10 17902296 missense probably damaging 1.00
R5737:Heca UTSW 10 17915714 missense possibly damaging 0.76
R6321:Heca UTSW 10 17915243 unclassified probably null
R6630:Heca UTSW 10 17908108 nonsense probably null
R7100:Heca UTSW 10 17915373 missense probably benign 0.00
R7381:Heca UTSW 10 17915524 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGGGCTGCAAGAATGAACTTCC -3'
(R):5'- AGTCGGTTCTGCAGCCTATG -3'

Sequencing Primer
(F):5'- GAATGAACTTCCGCAGATCTTCG -3'
(R):5'- CTTGTGGCTCCCCTGGC -3'
Posted On2015-10-08