Mutagenetix > Incidental Mutation

Incidental Mutation 'R0265:Ltbp2'

34874

Institutional Source

Beutler Lab

Gene Symbol

Ltbp2

Ensembl Gene

ENSMUSG00000002020

Gene Name

latent transforming growth factor beta binding protein 2

Synonyms

MMRRC Submission

038491-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.714) question?

Stock #

R0265 (G1)

Quality Score

138

Status

Validated

Chromosome

Chromosomal Location

84783212-84876532 bp(-) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

C to T at 84785969 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000127255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002073] [ENSMUST00000002073] [ENSMUST00000110254] [ENSMUST00000110254] [ENSMUST00000163189] [ENSMUST00000163189] [ENSMUST00000166383] [ENSMUST00000166383]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000002073

SMART Domains

Protein: ENSMUSP00000002073
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	99	108	N/A	INTRINSIC
EGF	184	213	6.55e-1	SMART
low complexity region	255	275	N/A	INTRINSIC
EGF	384	413	8.19e-2	SMART
low complexity region	515	526	N/A	INTRINSIC
Pfam:TB	546	582	3.8e-9	PFAM
EGF_CA	606	646	8.05e-10	SMART
Pfam:TB	666	707	3.4e-17	PFAM
EGF_CA	832	874	7.18e-7	SMART
EGF_CA	875	917	1.75e-10	SMART
EGF_CA	918	957	1.53e-10	SMART
EGF_CA	958	997	3.51e-10	SMART
EGF_CA	998	1038	8.3e-12	SMART
EGF_CA	1039	1080	4.56e-9	SMART
EGF_CA	1081	1122	4.56e-9	SMART
EGF_CA	1123	1163	8.76e-11	SMART
EGF_CA	1164	1205	4.38e-11	SMART
EGF_CA	1206	1246	1.75e-10	SMART
EGF_CA	1247	1290	2.24e-8	SMART
EGF_CA	1291	1332	6.01e-9	SMART
EGF	1336	1375	1.95e1	SMART
Pfam:TB	1410	1450	1.4e-13	PFAM
EGF_CA	1473	1515	2.31e-10	SMART
EGF_CA	1516	1555	7.93e-9	SMART
Pfam:TB	1582	1623	1e-13	PFAM
low complexity region	1691	1704	N/A	INTRINSIC
EGF	1724	1761	4e-5	SMART
EGF_CA	1762	1806	1.91e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000002073

SMART Domains

Protein: ENSMUSP00000002073
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	99	108	N/A	INTRINSIC
EGF	184	213	6.55e-1	SMART
low complexity region	255	275	N/A	INTRINSIC
EGF	384	413	8.19e-2	SMART
low complexity region	515	526	N/A	INTRINSIC
Pfam:TB	546	582	3.8e-9	PFAM
EGF_CA	606	646	8.05e-10	SMART
Pfam:TB	666	707	3.4e-17	PFAM
EGF_CA	832	874	7.18e-7	SMART
EGF_CA	875	917	1.75e-10	SMART
EGF_CA	918	957	1.53e-10	SMART
EGF_CA	958	997	3.51e-10	SMART
EGF_CA	998	1038	8.3e-12	SMART
EGF_CA	1039	1080	4.56e-9	SMART
EGF_CA	1081	1122	4.56e-9	SMART
EGF_CA	1123	1163	8.76e-11	SMART
EGF_CA	1164	1205	4.38e-11	SMART
EGF_CA	1206	1246	1.75e-10	SMART
EGF_CA	1247	1290	2.24e-8	SMART
EGF_CA	1291	1332	6.01e-9	SMART
EGF	1336	1375	1.95e1	SMART
Pfam:TB	1410	1450	1.4e-13	PFAM
EGF_CA	1473	1515	2.31e-10	SMART
EGF_CA	1516	1555	7.93e-9	SMART
Pfam:TB	1582	1623	1e-13	PFAM
low complexity region	1691	1704	N/A	INTRINSIC
EGF	1724	1761	4e-5	SMART
EGF_CA	1762	1806	1.91e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000110254

SMART Domains

Protein: ENSMUSP00000105883
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
low complexity region	119	128	N/A	INTRINSIC
EGF	204	233	6.55e-1	SMART
low complexity region	275	295	N/A	INTRINSIC
EGF	404	433	8.19e-2	SMART
low complexity region	535	546	N/A	INTRINSIC
Pfam:TB	565	602	4e-8	PFAM
EGF_CA	626	666	8.05e-10	SMART
Pfam:TB	685	727	3.7e-16	PFAM
EGF_CA	852	894	7.18e-7	SMART
EGF_CA	895	934	1.53e-10	SMART
EGF_CA	935	974	3.51e-10	SMART
EGF_CA	975	1015	8.3e-12	SMART
EGF_CA	1016	1057	4.56e-9	SMART
EGF_CA	1058	1099	4.56e-9	SMART
EGF_CA	1100	1140	8.76e-11	SMART
EGF_CA	1141	1182	4.38e-11	SMART
EGF_CA	1183	1223	1.75e-10	SMART
EGF_CA	1224	1267	2.24e-8	SMART
EGF_CA	1268	1309	6.01e-9	SMART
EGF	1313	1352	1.95e1	SMART
Pfam:TB	1387	1427	1.4e-11	PFAM
EGF_CA	1450	1492	2.31e-10	SMART
EGF_CA	1493	1532	7.93e-9	SMART
Pfam:TB	1558	1600	4.6e-13	PFAM
low complexity region	1668	1681	N/A	INTRINSIC
EGF	1701	1738	4e-5	SMART
EGF_CA	1739	1783	1.91e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000110254

SMART Domains

Protein: ENSMUSP00000105883
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
low complexity region	119	128	N/A	INTRINSIC
EGF	204	233	6.55e-1	SMART
low complexity region	275	295	N/A	INTRINSIC
EGF	404	433	8.19e-2	SMART
low complexity region	535	546	N/A	INTRINSIC
Pfam:TB	565	602	4e-8	PFAM
EGF_CA	626	666	8.05e-10	SMART
Pfam:TB	685	727	3.7e-16	PFAM
EGF_CA	852	894	7.18e-7	SMART
EGF_CA	895	934	1.53e-10	SMART
EGF_CA	935	974	3.51e-10	SMART
EGF_CA	975	1015	8.3e-12	SMART
EGF_CA	1016	1057	4.56e-9	SMART
EGF_CA	1058	1099	4.56e-9	SMART
EGF_CA	1100	1140	8.76e-11	SMART
EGF_CA	1141	1182	4.38e-11	SMART
EGF_CA	1183	1223	1.75e-10	SMART
EGF_CA	1224	1267	2.24e-8	SMART
EGF_CA	1268	1309	6.01e-9	SMART
EGF	1313	1352	1.95e1	SMART
Pfam:TB	1387	1427	1.4e-11	PFAM
EGF_CA	1450	1492	2.31e-10	SMART
EGF_CA	1493	1532	7.93e-9	SMART
Pfam:TB	1558	1600	4.6e-13	PFAM
low complexity region	1668	1681	N/A	INTRINSIC
EGF	1701	1738	4e-5	SMART
EGF_CA	1739	1783	1.91e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000163189

SMART Domains

Protein: ENSMUSP00000127693
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	99	108	N/A	INTRINSIC
EGF	184	213	6.55e-1	SMART
low complexity region	255	275	N/A	INTRINSIC
EGF	384	413	8.19e-2	SMART
low complexity region	515	526	N/A	INTRINSIC
Pfam:TB	545	582	4e-8	PFAM
EGF_CA	606	646	8.05e-10	SMART
Pfam:TB	665	707	3.8e-16	PFAM
EGF_CA	832	874	7.18e-7	SMART
EGF_CA	875	914	1.53e-10	SMART
EGF_CA	915	954	3.51e-10	SMART
EGF_CA	955	995	8.3e-12	SMART
EGF_CA	996	1037	4.56e-9	SMART
EGF_CA	1038	1079	4.56e-9	SMART
EGF_CA	1080	1120	8.76e-11	SMART
EGF_CA	1121	1162	4.38e-11	SMART
EGF_CA	1163	1203	1.75e-10	SMART
EGF_CA	1204	1247	2.24e-8	SMART
EGF_CA	1248	1289	6.01e-9	SMART
EGF	1293	1332	1.95e1	SMART
Pfam:TB	1367	1407	1.5e-11	PFAM
EGF_CA	1430	1472	2.31e-10	SMART
EGF_CA	1473	1512	7.93e-9	SMART
Pfam:TB	1538	1580	4.7e-13	PFAM
low complexity region	1648	1661	N/A	INTRINSIC
EGF	1681	1718	4e-5	SMART
EGF_CA	1719	1763	1.91e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000163189

SMART Domains

Protein: ENSMUSP00000127693
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	99	108	N/A	INTRINSIC
EGF	184	213	6.55e-1	SMART
low complexity region	255	275	N/A	INTRINSIC
EGF	384	413	8.19e-2	SMART
low complexity region	515	526	N/A	INTRINSIC
Pfam:TB	545	582	4e-8	PFAM
EGF_CA	606	646	8.05e-10	SMART
Pfam:TB	665	707	3.8e-16	PFAM
EGF_CA	832	874	7.18e-7	SMART
EGF_CA	875	914	1.53e-10	SMART
EGF_CA	915	954	3.51e-10	SMART
EGF_CA	955	995	8.3e-12	SMART
EGF_CA	996	1037	4.56e-9	SMART
EGF_CA	1038	1079	4.56e-9	SMART
EGF_CA	1080	1120	8.76e-11	SMART
EGF_CA	1121	1162	4.38e-11	SMART
EGF_CA	1163	1203	1.75e-10	SMART
EGF_CA	1204	1247	2.24e-8	SMART
EGF_CA	1248	1289	6.01e-9	SMART
EGF	1293	1332	1.95e1	SMART
Pfam:TB	1367	1407	1.5e-11	PFAM
EGF_CA	1430	1472	2.31e-10	SMART
EGF_CA	1473	1512	7.93e-9	SMART
Pfam:TB	1538	1580	4.7e-13	PFAM
low complexity region	1648	1661	N/A	INTRINSIC
EGF	1681	1718	4e-5	SMART
EGF_CA	1719	1763	1.91e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163214

SMART Domains

Protein: ENSMUSP00000132067
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
EGF_CA	6	46	8.76e-11	SMART
EGF_CA	47	90	2.24e-8	SMART
EGF_CA	91	132	6.01e-9	SMART
EGF	136	175	1.95e1	SMART
Pfam:TB	210	250	1.5e-14	PFAM
EGF	276	307	1.5e1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000166383

SMART Domains

Protein: ENSMUSP00000127255
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
EGF_CA	8	49	2.13e-9	SMART
Pfam:TB	75	117	1.3e-14	PFAM
low complexity region	185	198	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166383

SMART Domains

Protein: ENSMUSP00000127255
Gene: ENSMUSG00000002020

Domain	Start	End	E-Value	Type
EGF_CA	8	49	2.13e-9	SMART
Pfam:TB	75	117	1.3e-14	PFAM
low complexity region	185	198	N/A	INTRINSIC

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.6%
20x: 92.0%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent transforming growth factor (TGF)-beta binding proteins (LTBP), which are extracellular matrix proteins with multi-domain structure. This protein is the largest member of the LTBP family possessing unique regions and with most similarity to the fibrillins. It has thus been suggested that it may have multiple functions: as a member of the TGF-beta latent complex, as a structural component of microfibrils, and a role in cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early embryonic lethality prior to E6.5. Mice homozygous for a different null allele are viable, fertile, and developmentally normal but develop lens dislocations due to ciliary zonule fragmentation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	G	14: 8,431,667	Y655S	probably damaging	Het
9330182L06Rik	T	C	5: 9,434,681	L486P	probably damaging	Het
Abca14	A	G	7: 120,223,627	I321V	probably benign	Het
Adcy7	A	G	8: 88,324,763	D837G	probably damaging	Het
Aldh1a1	T	A	19: 20,640,076	Y457*	probably null	Het
Alox5	T	C	6: 116,420,362	Y287C	probably benign	Het
Ano8	T	C	8: 71,480,524		probably benign	Het
Ap3b1	A	G	13: 94,493,681	K815E	unknown	Het
Atp11a	A	T	8: 12,856,930		probably benign	Het
Atp6v0a1	A	T	11: 101,048,515	D702V	possibly damaging	Het
Cacna1b	T	A	2: 24,761,844	N108Y	probably damaging	Het
Ccdc57	G	C	11: 120,921,811	A39G	probably benign	Het
Cdhr1	A	T	14: 37,081,376	V581D	probably benign	Het
Cyp2b23	A	G	7: 26,672,879		probably benign	Het
D430041D05Rik	G	C	2: 104,167,950	P1836R	probably damaging	Het
Ddit4l	C	T	3: 137,624,287		probably benign	Het
Dnah8	A	T	17: 30,690,271	I1024F	probably benign	Het
Edc3	T	A	9: 57,727,338	F213I	probably damaging	Het
Edrf1	G	A	7: 133,657,045	D717N	probably damaging	Het
Efna5	G	A	17: 62,651,073	P63S	probably damaging	Het
Entpd3	A	G	9: 120,558,481	Y248C	probably damaging	Het
Flcn	G	A	11: 59,795,809	Q373*	probably null	Het
Fry	T	C	5: 150,434,776	V1908A	probably damaging	Het
Gabrg3	A	T	7: 57,381,617	Y58*	probably null	Het
Gabrp	A	T	11: 33,552,614	Y417N	probably damaging	Het
Golga2	C	A	2: 32,304,952		probably null	Het
Grip2	C	A	6: 91,773,792		probably null	Het
Gsx2	A	G	5: 75,077,068	Y227C	probably damaging	Het
Hif3a	T	C	7: 17,035,868	*665W	probably null	Het
Hist1h2aa	T	C	13: 23,934,649	V63A	probably benign	Het
Hsd3b1	C	A	3: 98,852,773	V301L	probably damaging	Het
Ifitm5	T	C	7: 140,950,008		probably benign	Het
Inpp4a	A	T	1: 37,378,986	D498V	probably damaging	Het
Itga1	A	T	13: 114,992,459	D554E	probably benign	Het
Itk	G	A	11: 46,389,458		probably benign	Het
Kdm3b	T	A	18: 34,795,663		probably benign	Het
Klhl6	A	G	16: 19,948,234	V470A	probably benign	Het
Lamb3	T	A	1: 193,320,531	W95R	probably damaging	Het
Lbhd2	T	A	12: 111,410,242	I41N	probably damaging	Het
Lrp4	A	T	2: 91,490,670	S1014C	probably damaging	Het
Map3k19	A	G	1: 127,822,182	I1144T	possibly damaging	Het
Mfsd10	T	C	5: 34,635,163		probably benign	Het
Mocos	A	G	18: 24,666,276	D189G	probably benign	Het
Mvb12a	T	A	8: 71,547,010	F224L	probably damaging	Het
Myo15	A	T	11: 60,514,897		probably null	Het
Nos2	A	T	11: 78,937,602	H249L	probably damaging	Het
Notum	A	G	11: 120,658,334	M184T	probably benign	Het
Nvl	C	A	1: 181,134,830	D192Y	probably damaging	Het
Olfr1024	T	A	2: 85,904,247	N269I	probably benign	Het
Olfr1065	C	A	2: 86,445,959	V8L	probably benign	Het
Olfr1308	T	C	2: 111,960,494	Y193C	probably damaging	Het
Olfr204	A	T	16: 59,315,071	F112Y	probably damaging	Het
Olfr218	A	G	1: 173,203,917	K187R	probably benign	Het
Osgin1	A	G	8: 119,445,657	I397V	possibly damaging	Het
Otulin	A	G	15: 27,616,424	V123A	probably damaging	Het
P4ha1	A	G	10: 59,348,259	Y181C	probably damaging	Het
Pcdhgc5	A	T	18: 37,821,350	D559V	probably damaging	Het
Phf2	T	C	13: 48,828,794	N151S	unknown	Het
Plxnc1	C	A	10: 94,813,129	G1263C	probably benign	Het
Rad51ap1	A	G	6: 126,924,197	*338Q	probably null	Het
Raver1	A	G	9: 21,075,659	S676P	probably benign	Het
Rfx8	T	C	1: 39,688,577	E196G	possibly damaging	Het
Rreb1	A	T	13: 37,916,155	K187*	probably null	Het
Rxfp1	T	C	3: 79,667,654	T217A	probably benign	Het
Rxra	T	C	2: 27,752,430	L305P	probably damaging	Het
Sardh	T	C	2: 27,227,066		probably benign	Het
Skor2	A	T	18: 76,876,598	E952D	probably damaging	Het
Slc22a29	A	T	19: 8,169,970	S343T	probably benign	Het
Sorbs2	T	C	8: 45,785,337		probably benign	Het
Supt7l	C	T	5: 31,515,918	V329I	probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tac1	T	C	6: 7,559,165		probably benign	Het
Tcn2	A	T	11: 3,922,044	V361D	probably damaging	Het
Tm2d3	G	A	7: 65,697,834	A170T	possibly damaging	Het
Tnks	G	A	8: 34,839,970	R1142*	probably null	Het
Ttll7	C	A	3: 146,944,160	Y648*	probably null	Het
Umod	G	T	7: 119,466,073	Q578K	probably benign	Het
Upf2	G	A	2: 6,027,204		probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Washc5	A	G	15: 59,338,960	I1013T	probably benign	Het
Wdr60	T	C	12: 116,257,406		probably benign	Het
Zfp704	C	A	3: 9,565,157	R48L	probably damaging	Het

Other mutations in Ltbp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Ltbp2	APN	12	84791064	missense	probably damaging	1.00
IGL00938:Ltbp2	APN	12	84831799	missense	probably benign	0.03
IGL01397:Ltbp2	APN	12	84790268	missense	probably damaging	1.00
IGL01570:Ltbp2	APN	12	84794033	missense	probably benign	0.05
IGL01631:Ltbp2	APN	12	84809146	critical splice donor site	probably null
IGL01662:Ltbp2	APN	12	84809246	missense	probably benign	0.00
IGL01728:Ltbp2	APN	12	84791009	missense	probably damaging	0.99
IGL01839:Ltbp2	APN	12	84793658	missense	possibly damaging	0.48
IGL01946:Ltbp2	APN	12	84830748	missense	probably damaging	1.00
IGL01977:Ltbp2	APN	12	84830199	missense	probably damaging	1.00
IGL02220:Ltbp2	APN	12	84829309	missense	possibly damaging	0.93
IGL02340:Ltbp2	APN	12	84792955	critical splice donor site	probably null
IGL02430:Ltbp2	APN	12	84799401	missense	probably damaging	1.00
IGL02492:Ltbp2	APN	12	84809665	missense	probably damaging	1.00
IGL02517:Ltbp2	APN	12	84785317	missense	probably benign	0.42
IGL02794:Ltbp2	APN	12	84791935	missense	probably damaging	1.00
deft	UTSW	12	84853912	missense	probably damaging	0.98
masterful	UTSW	12	84791090	missense	probably benign	0.00
practiced	UTSW	12	84809348	missense	probably damaging	1.00
R0045:Ltbp2	UTSW	12	84809587	missense	probably damaging	1.00
R0045:Ltbp2	UTSW	12	84813288	missense	probably damaging	1.00
R0091:Ltbp2	UTSW	12	84793733	missense	probably damaging	1.00
R0094:Ltbp2	UTSW	12	84799426	missense	probably damaging	1.00
R0166:Ltbp2	UTSW	12	84786358	missense	probably benign	0.28
R0394:Ltbp2	UTSW	12	84806424	splice site	probably benign
R0535:Ltbp2	UTSW	12	84784858	missense	probably damaging	1.00
R0535:Ltbp2	UTSW	12	84791052	missense	probably damaging	1.00
R1465:Ltbp2	UTSW	12	84813300	missense	probably damaging	1.00
R1465:Ltbp2	UTSW	12	84813300	missense	probably damaging	1.00
R1513:Ltbp2	UTSW	12	84791944	missense	probably damaging	1.00
R1858:Ltbp2	UTSW	12	84830781	nonsense	probably null
R1880:Ltbp2	UTSW	12	84829271	missense	probably benign	0.45
R1894:Ltbp2	UTSW	12	84787961	missense	probably damaging	1.00
R1900:Ltbp2	UTSW	12	84830658	missense	probably damaging	1.00
R1903:Ltbp2	UTSW	12	84830105	missense	probably benign	0.01
R1912:Ltbp2	UTSW	12	84785863	missense	probably damaging	0.98
R1993:Ltbp2	UTSW	12	84808446	critical splice acceptor site	probably null
R1995:Ltbp2	UTSW	12	84808446	critical splice acceptor site	probably null
R2069:Ltbp2	UTSW	12	84793733	missense	probably damaging	1.00
R2126:Ltbp2	UTSW	12	84785709	splice site	probably null
R2139:Ltbp2	UTSW	12	84815979	missense	probably damaging	1.00
R2341:Ltbp2	UTSW	12	84809163	missense	probably benign	0.08
R2511:Ltbp2	UTSW	12	84804409	splice site	probably null
R3737:Ltbp2	UTSW	12	84804474	missense	probably damaging	1.00
R3738:Ltbp2	UTSW	12	84804474	missense	probably damaging	1.00
R3739:Ltbp2	UTSW	12	84804474	missense	probably damaging	1.00
R3889:Ltbp2	UTSW	12	84784907	unclassified	probably benign
R4034:Ltbp2	UTSW	12	84804474	missense	probably damaging	1.00
R4542:Ltbp2	UTSW	12	84831819	nonsense	probably null
R4621:Ltbp2	UTSW	12	84809348	missense	probably damaging	1.00
R4623:Ltbp2	UTSW	12	84809348	missense	probably damaging	1.00
R4831:Ltbp2	UTSW	12	84793640	missense	possibly damaging	0.55
R5080:Ltbp2	UTSW	12	84803864	missense	probably damaging	1.00
R5116:Ltbp2	UTSW	12	84809737	missense	probably damaging	1.00
R5351:Ltbp2	UTSW	12	84790358	missense	possibly damaging	0.95
R5445:Ltbp2	UTSW	12	84809654	missense	probably null	1.00
R5608:Ltbp2	UTSW	12	84787464	splice site	probably null
R5784:Ltbp2	UTSW	12	84868739	missense	probably damaging	1.00
R5838:Ltbp2	UTSW	12	84789101	missense	probably benign	0.16
R5859:Ltbp2	UTSW	12	84794063	missense	possibly damaging	0.52
R6004:Ltbp2	UTSW	12	84876149	missense	probably benign	0.00
R6028:Ltbp2	UTSW	12	84784852	missense	probably damaging	1.00
R6347:Ltbp2	UTSW	12	84853912	missense	probably damaging	0.98
R6615:Ltbp2	UTSW	12	84813317	missense	probably damaging	1.00
R6636:Ltbp2	UTSW	12	84875838	missense	probably benign	0.00
R6637:Ltbp2	UTSW	12	84875838	missense	probably benign	0.00
R6755:Ltbp2	UTSW	12	84795073	missense	probably damaging	1.00
R6759:Ltbp2	UTSW	12	84787410	missense	probably damaging	0.99
R6806:Ltbp2	UTSW	12	84809238	missense	possibly damaging	0.74
R6968:Ltbp2	UTSW	12	84789083	critical splice donor site	probably null
R7084:Ltbp2	UTSW	12	84868685	missense	probably damaging	1.00
R7250:Ltbp2	UTSW	12	84787392	nonsense	probably null
R7374:Ltbp2	UTSW	12	84830175	missense	probably damaging	1.00
R7501:Ltbp2	UTSW	12	84830645	missense	probably damaging	1.00
R7523:Ltbp2	UTSW	12	84791034	missense	probably benign	0.00
R7754:Ltbp2	UTSW	12	84813238	critical splice donor site	probably null
R7827:Ltbp2	UTSW	12	84789881	missense	probably benign	0.19
R8042:Ltbp2	UTSW	12	84791899	missense	probably damaging	0.99
R8110:Ltbp2	UTSW	12	84803902	nonsense	probably null
R8411:Ltbp2	UTSW	12	84786413	missense	probably damaging	1.00
R8688:Ltbp2	UTSW	12	84803804	missense	probably benign	0.20
R8711:Ltbp2	UTSW	12	84853741	missense	probably benign	0.00
R8712:Ltbp2	UTSW	12	84806350	missense	probably benign	0.08
R8893:Ltbp2	UTSW	12	84828542	missense	probably damaging	1.00
R8978:Ltbp2	UTSW	12	84787390	missense	probably benign	0.00
R9016:Ltbp2	UTSW	12	84809693	missense	probably benign	0.02
R9123:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9129:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9132:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9144:Ltbp2	UTSW	12	84809652	missense	probably damaging	1.00
R9150:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9152:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9156:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9157:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9158:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9159:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9160:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9199:Ltbp2	UTSW	12	84785976	missense	probably benign	0.09
R9212:Ltbp2	UTSW	12	84793050	missense	probably damaging	1.00
R9275:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9276:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9276:Ltbp2	UTSW	12	84830111	missense	possibly damaging	0.79
R9278:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9279:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9280:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9281:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9312:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9313:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9331:Ltbp2	UTSW	12	84876191	missense	probably benign
R9355:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9375:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9377:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9378:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9450:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9457:Ltbp2	UTSW	12	84789153	missense	probably benign	0.19
R9486:Ltbp2	UTSW	12	84831874	missense	possibly damaging	0.49
R9505:Ltbp2	UTSW	12	84853864	missense	probably damaging	1.00
R9512:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9581:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9582:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9645:Ltbp2	UTSW	12	84791090	missense	probably benign	0.00
R9747:Ltbp2	UTSW	12	84868741	missense	probably damaging	1.00
R9792:Ltbp2	UTSW	12	84829354	missense	probably damaging	0.99
R9795:Ltbp2	UTSW	12	84829354	missense	probably damaging	0.99
X0017:Ltbp2	UTSW	12	84828528	missense	probably damaging	1.00
X0026:Ltbp2	UTSW	12	84830199	missense	probably damaging	1.00
Z1176:Ltbp2	UTSW	12	84875853	missense	probably benign	0.01
Z1177:Ltbp2	UTSW	12	84829316	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CTGAATGACCTGGACTAAGGGCAAG -3'
(R):5'- CAAAAGGCCACTTCTGGACCTTCTC -3'

Sequencing Primer
(F):5'- ATCTTGGCAGCAGCATTCTG -3'
(R):5'- CCACTTTTTCCTCACACCACAG -3'

Posted On

2013-05-09