Incidental Mutation 'R4626:Olfr3'
ID348757
Institutional Source Beutler Lab
Gene Symbol Olfr3
Ensembl Gene ENSMUSG00000075384
Gene Nameolfactory receptor 3
SynonymsMOR136-14, Y71, GA_x6K02T2NLDC-33507606-33506665
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R4626 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36811492-36817032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36812259 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 278 (Y278H)
Ref Sequence ENSEMBL: ENSMUSP00000149118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100151] [ENSMUST00000213988]
Predicted Effect probably damaging
Transcript: ENSMUST00000100151
AA Change: Y278H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097728
Gene: ENSMUSG00000075384
AA Change: Y278H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 220 2.9e-7 PFAM
Pfam:7tm_1 41 290 6.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120418
Predicted Effect probably damaging
Transcript: ENSMUST00000213988
AA Change: Y278H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Olfr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Olfr3 APN 2 36812403 missense probably benign
R0501:Olfr3 UTSW 2 36812480 nonsense probably null
R0519:Olfr3 UTSW 2 36812615 missense probably damaging 1.00
R0890:Olfr3 UTSW 2 36812574 missense probably benign 0.06
R1353:Olfr3 UTSW 2 36812914 missense possibly damaging 0.59
R1543:Olfr3 UTSW 2 36813057 missense probably damaging 1.00
R3435:Olfr3 UTSW 2 36812678 missense probably benign 0.06
R4378:Olfr3 UTSW 2 36812469 missense probably benign
R4585:Olfr3 UTSW 2 36812525 missense probably damaging 1.00
R4586:Olfr3 UTSW 2 36812525 missense probably damaging 1.00
R4714:Olfr3 UTSW 2 36813035 missense probably benign 0.37
R4720:Olfr3 UTSW 2 36812472 missense probably benign 0.03
R5390:Olfr3 UTSW 2 36812432 missense probably benign
R5659:Olfr3 UTSW 2 36812954 missense probably damaging 1.00
R5681:Olfr3 UTSW 2 36812681 missense probably benign 0.18
R6750:Olfr3 UTSW 2 36812942 missense possibly damaging 0.90
R7003:Olfr3 UTSW 2 36813035 missense possibly damaging 0.51
R7353:Olfr3 UTSW 2 36812903 missense probably damaging 1.00
R7514:Olfr3 UTSW 2 36812639 missense probably benign 0.03
R8094:Olfr3 UTSW 2 36812318 missense probably damaging 1.00
R8298:Olfr3 UTSW 2 36813026 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAGCAAAGCATTCAGAGGG -3'
(R):5'- CTTATGGCCGTATTGGGTTCAC -3'

Sequencing Primer
(F):5'- CATTCAGAGGGAGAGCAGTAAATG -3'
(R):5'- TGGGTTCACCATCCTCCAGG -3'
Posted On2015-10-08