Incidental Mutation 'R4626:F2'
ID348760
Institutional Source Beutler Lab
Gene Symbol F2
Ensembl Gene ENSMUSG00000027249
Gene Namecoagulation factor II
SynonymsFII, Cf2, Cf-2, thrombin, prothrombin
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4626 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91625320-91636414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91630670 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 239 (N239I)
Ref Sequence ENSEMBL: ENSMUSP00000106967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028681] [ENSMUST00000111335]
Predicted Effect probably benign
Transcript: ENSMUST00000028681
AA Change: N240I

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028681
Gene: ENSMUSG00000027249
AA Change: N240I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 7.47e-37 SMART
KR 213 295 5.09e-30 SMART
Tryp_SPc 360 610 9.99e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111335
AA Change: N239I

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106967
Gene: ENSMUSG00000027249
AA Change: N239I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 8.01e-37 SMART
KR 212 294 5.09e-30 SMART
Tryp_SPc 359 609 9.99e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153182
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent glycoprotein coagulation factor that plays an important role in the process of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that undergoes enzymatic cleavage by the coagulation factor Xa to form an active serine protease that converts soluble fibrinogen to insoluble fibrin clot. Most of the mice lacking the encoded protein die at an embryonic stage due to defects in yolk sac vasculature, while the rare nenonates succumb to hemorrhage on the first postnatal day. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in yolk sac vasculature, internal bleeding, tissue necrosis, and die in mid- to late-gestation, or rarely, a few days after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in F2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02334:F2 APN 2 91633094 missense probably benign 0.16
IGL02390:F2 APN 2 91632987 missense possibly damaging 0.81
IGL02859:F2 APN 2 91625742 missense probably damaging 1.00
IGL02970:F2 APN 2 91625551 missense possibly damaging 0.95
IGL03278:F2 APN 2 91635182 missense probably benign 0.01
Sarode UTSW 2 91635194 missense probably benign 0.35
R0007:F2 UTSW 2 91630607 missense probably benign 0.00
R0015:F2 UTSW 2 91630607 missense probably benign 0.00
R0137:F2 UTSW 2 91625730 missense probably damaging 1.00
R0211:F2 UTSW 2 91630158 missense probably damaging 1.00
R0304:F2 UTSW 2 91633233 missense probably damaging 0.99
R0601:F2 UTSW 2 91633311 splice site probably null
R0830:F2 UTSW 2 91630200 missense probably benign 0.34
R1693:F2 UTSW 2 91629179 missense probably damaging 1.00
R1720:F2 UTSW 2 91628830 nonsense probably null
R1763:F2 UTSW 2 91634906 missense probably damaging 1.00
R1865:F2 UTSW 2 91635194 missense probably benign 0.35
R1955:F2 UTSW 2 91633095 missense probably benign 0.01
R2055:F2 UTSW 2 91628442 missense probably benign 0.00
R2168:F2 UTSW 2 91628348 missense probably damaging 0.98
R2230:F2 UTSW 2 91625757 missense probably benign 0.01
R3916:F2 UTSW 2 91625488 missense probably damaging 1.00
R4004:F2 UTSW 2 91628396 missense possibly damaging 0.88
R4134:F2 UTSW 2 91629208 missense possibly damaging 0.93
R4298:F2 UTSW 2 91629320 critical splice acceptor site probably null
R4902:F2 UTSW 2 91634971 intron probably benign
R5093:F2 UTSW 2 91634957 splice site probably benign
R5095:F2 UTSW 2 91634957 splice site probably benign
R5140:F2 UTSW 2 91634957 splice site probably benign
R5229:F2 UTSW 2 91630241 nonsense probably null
R5271:F2 UTSW 2 91635121 intron probably benign
R5335:F2 UTSW 2 91634932 missense possibly damaging 0.68
R7650:F2 UTSW 2 91628396 missense possibly damaging 0.88
R7762:F2 UTSW 2 91628696 missense possibly damaging 0.61
R8178:F2 UTSW 2 91630273 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGTTAAGAGTCTAGGCACACC -3'
(R):5'- ATCCTTCTTCACCAGGCCAG -3'

Sequencing Primer
(F):5'- AGGCTGTAATGAACCCACTTG -3'
(R):5'- AGGAGGGCCGTACCACTG -3'
Posted On2015-10-08