Incidental Mutation 'R4626:Orc5'
ID348767
Institutional Source Beutler Lab
Gene Symbol Orc5
Ensembl Gene ENSMUSG00000029012
Gene Nameorigin recognition complex, subunit 5
SynonymsMmORC5, mouse origin recognition complex 5, Orc5l
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R4626 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location22486485-22550429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 22548005 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 10 (F10L)
Ref Sequence ENSEMBL: ENSMUSP00000120214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030872] [ENSMUST00000141263]
Predicted Effect probably benign
Transcript: ENSMUST00000030872
AA Change: F28L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030872
Gene: ENSMUSG00000029012
AA Change: F28L

DomainStartEndE-ValueType
Pfam:AAA_16 7 155 2.4e-15 PFAM
Pfam:AAA_22 28 160 2.9e-9 PFAM
Pfam:ORC5_C 177 431 5.1e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138248
Predicted Effect probably benign
Transcript: ENSMUST00000141263
AA Change: F10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120214
Gene: ENSMUSG00000029012
AA Change: F10L

DomainStartEndE-ValueType
Pfam:AAA_16 3 137 2.6e-9 PFAM
Pfam:AAA_22 11 144 1.1e-9 PFAM
Pfam:ORC5_C 159 312 2.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195898
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Orc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Orc5 APN 5 22523539 missense probably damaging 0.99
IGL00488:Orc5 APN 5 22516773 missense probably damaging 0.99
IGL01915:Orc5 APN 5 22522383 unclassified probably benign
IGL02385:Orc5 APN 5 22526440 missense probably damaging 1.00
IGL02830:Orc5 APN 5 22529267 missense probably damaging 1.00
IGL03128:Orc5 APN 5 22516773 missense probably damaging 0.99
R0372:Orc5 UTSW 5 22533784 missense possibly damaging 0.91
R0446:Orc5 UTSW 5 22546457 missense probably benign 0.19
R2060:Orc5 UTSW 5 22516703 critical splice donor site probably null
R2144:Orc5 UTSW 5 22547927 missense possibly damaging 0.94
R2375:Orc5 UTSW 5 22546552 missense probably damaging 1.00
R3875:Orc5 UTSW 5 22537566 missense probably benign 0.00
R4620:Orc5 UTSW 5 22529176 missense probably damaging 1.00
R4625:Orc5 UTSW 5 22548005 missense probably benign
R4627:Orc5 UTSW 5 22548005 missense probably benign
R4629:Orc5 UTSW 5 22548005 missense probably benign
R4664:Orc5 UTSW 5 22546522 missense probably benign
R5751:Orc5 UTSW 5 22499971 splice site probably null
R5758:Orc5 UTSW 5 22529258 missense possibly damaging 0.81
R7013:Orc5 UTSW 5 22533789 missense probably benign 0.16
R7326:Orc5 UTSW 5 22523584 missense probably benign 0.27
R7579:Orc5 UTSW 5 22550199 missense possibly damaging 0.94
R7794:Orc5 UTSW 5 22533784 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCACTGGGTGGTGAAATAAATTGTC -3'
(R):5'- AGGGGACACACGTTGAGTTG -3'

Sequencing Primer
(F):5'- GGTGGTGAAATAAATTGTCTCGATTC -3'
(R):5'- TTTAATCCCAGCACTCGGGAG -3'
Posted On2015-10-08