Incidental Mutation 'R4626:Lrguk'
ID 348775
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 041891-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R4626 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34106158 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 728 (E728K)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189]
AlphaFold Q9D5S7
Predicted Effect probably benign
Transcript: ENSMUST00000070189
AA Change: E728K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: E728K

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,313,784 (GRCm39) *527G probably null Het
Abca17 A T 17: 24,540,058 (GRCm39) I390N probably damaging Het
Adamts18 C T 8: 114,499,800 (GRCm39) W371* probably null Het
Akr1c13 G T 13: 4,247,869 (GRCm39) V214F probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Ankrd49 A C 9: 14,693,936 (GRCm39) L77R probably damaging Het
Ap3b1 T A 13: 94,540,586 (GRCm39) N169K possibly damaging Het
Arhgap39 A C 15: 76,621,837 (GRCm39) F255V possibly damaging Het
Atp1a3 T A 7: 24,698,193 (GRCm39) N171I possibly damaging Het
Atp9a T C 2: 168,481,863 (GRCm39) D953G probably damaging Het
Atxn1 T C 13: 45,720,575 (GRCm39) Y440C probably damaging Het
Bccip T C 7: 133,322,457 (GRCm39) Y268H possibly damaging Het
Brms1l C A 12: 55,909,958 (GRCm39) P243T probably benign Het
Btbd10 T C 7: 112,927,605 (GRCm39) E250G probably damaging Het
Cacna1e T C 1: 154,358,294 (GRCm39) probably null Het
Cfhr2 A T 1: 139,741,314 (GRCm39) N220K probably damaging Het
Csnk1g2 C A 10: 80,475,648 (GRCm39) A405E probably damaging Het
D5Ertd579e T C 5: 36,771,903 (GRCm39) I831V possibly damaging Het
F2 T A 2: 91,461,015 (GRCm39) N239I probably benign Het
Fbln5 T A 12: 101,727,086 (GRCm39) D301V probably damaging Het
Fbn2 A T 18: 58,146,819 (GRCm39) C2692* probably null Het
Fhdc1 C T 3: 84,381,557 (GRCm39) D34N probably damaging Het
Galnt13 T A 2: 54,747,878 (GRCm39) M253K probably damaging Het
Gpc6 C A 14: 118,202,255 (GRCm39) Y488* probably null Het
Grm5 G T 7: 87,779,361 (GRCm39) G934C probably damaging Het
Gys1 T C 7: 45,088,958 (GRCm39) L119S probably damaging Het
H2-T15 CTGGGTG CTG 17: 36,368,788 (GRCm39) probably null Het
Htra4 T C 8: 25,527,130 (GRCm39) N222D probably benign Het
Iba57 A G 11: 59,049,287 (GRCm39) V294A probably benign Het
Kctd21 A G 7: 96,996,782 (GRCm39) D85G probably damaging Het
Krt1 C T 15: 101,754,622 (GRCm39) G543S unknown Het
Lama5 G A 2: 179,826,253 (GRCm39) T2330M probably damaging Het
Mcm6 T C 1: 128,279,285 (GRCm39) D167G probably benign Het
Mettl18 T A 1: 163,824,045 (GRCm39) V122E probably damaging Het
Mindy2 G A 9: 70,534,063 (GRCm39) S378L probably damaging Het
Mis18bp1 G T 12: 65,187,540 (GRCm39) F854L probably damaging Het
Mtdh C T 15: 34,114,980 (GRCm39) R106* probably null Het
Nup214 T A 2: 31,923,416 (GRCm39) V1315E possibly damaging Het
Nup58 A G 14: 60,476,004 (GRCm39) V271A probably benign Het
Or1j1 A G 2: 36,702,271 (GRCm39) Y278H probably damaging Het
Or4c101 T C 2: 88,390,176 (GRCm39) V121A possibly damaging Het
Or6f2 T C 7: 139,756,359 (GRCm39) S109P probably damaging Het
Orc5 G T 5: 22,753,003 (GRCm39) F10L probably benign Het
Pcdha11 A T 18: 37,140,051 (GRCm39) N560I probably damaging Het
Pcdhb9 T A 18: 37,535,302 (GRCm39) F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 (GRCm39) probably benign Het
Poll C A 19: 45,543,563 (GRCm39) M385I probably benign Het
Pomt1 A G 2: 32,144,424 (GRCm39) K737E possibly damaging Het
Prr16 C T 18: 51,435,911 (GRCm39) T130I probably damaging Het
Ptpn18 A G 1: 34,510,873 (GRCm39) probably null Het
Ranbp6 A T 19: 29,788,263 (GRCm39) Y696* probably null Het
Rmi1 A G 13: 58,556,950 (GRCm39) R400G probably benign Het
Scn10a A G 9: 119,460,571 (GRCm39) I1101T possibly damaging Het
Slc22a22 T C 15: 57,126,734 (GRCm39) T93A probably damaging Het
Snx10 A G 6: 51,565,270 (GRCm39) D129G probably damaging Het
Stub1 A G 17: 26,050,845 (GRCm39) probably null Het
Tfr2 T C 5: 137,569,954 (GRCm39) V120A probably benign Het
Trmu T C 15: 85,779,186 (GRCm39) Y278H possibly damaging Het
Ugt2b36 A C 5: 87,239,947 (GRCm39) F146C probably damaging Het
Vav2 T C 2: 27,160,172 (GRCm39) I692V possibly damaging Het
Wdfy3 A G 5: 102,091,800 (GRCm39) L513P probably damaging Het
Zfhx4 T A 3: 5,467,699 (GRCm39) V2619D probably damaging Het
Zfyve26 T A 12: 79,315,844 (GRCm39) N1211Y possibly damaging Het
Zp3r A G 1: 130,542,912 (GRCm39) F142L probably damaging Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1604:Lrguk UTSW 6 34,049,305 (GRCm39) missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2107:Lrguk UTSW 6 34,039,296 (GRCm39) missense probably benign 0.15
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34,047,996 (GRCm39) missense probably damaging 1.00
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R5997:Lrguk UTSW 6 34,106,078 (GRCm39) missense probably damaging 0.99
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R6802:Lrguk UTSW 6 34,039,392 (GRCm39) missense probably damaging 1.00
R7081:Lrguk UTSW 6 34,079,074 (GRCm39) missense probably benign 0.01
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7473:Lrguk UTSW 6 34,006,630 (GRCm39) missense probably benign 0.01
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7613:Lrguk UTSW 6 34,078,683 (GRCm39) missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34,072,474 (GRCm39) missense probably damaging 1.00
R7900:Lrguk UTSW 6 34,106,129 (GRCm39) missense probably benign 0.01
R8012:Lrguk UTSW 6 34,033,038 (GRCm39) missense probably benign 0.00
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8551:Lrguk UTSW 6 34,093,446 (GRCm39) missense probably damaging 0.96
R8828:Lrguk UTSW 6 34,080,572 (GRCm39) missense unknown
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AAGCGAGTAATTTCCCTCAGC -3'
(R):5'- AAGCCTGCTCCTCACAGATC -3'

Sequencing Primer
(F):5'- CGAGTAATTTCCCTCAGCATGTGTAG -3'
(R):5'- GCTCCTCACAGATCTTAGTGACAGG -3'
Posted On 2015-10-08