Incidental Mutation 'R4626:Htra4'
ID348785
Institutional Source Beutler Lab
Gene Symbol Htra4
Ensembl Gene ENSMUSG00000037406
Gene NameHtrA serine peptidase 4
Synonyms
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4626 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25024929-25038962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25037114 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 222 (N222D)
Ref Sequence ENSEMBL: ENSMUSP00000081044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064883] [ENSMUST00000084031] [ENSMUST00000128715]
Predicted Effect probably benign
Transcript: ENSMUST00000064883
SMART Domains Protein: ENSMUSP00000066546
Gene: ENSMUSG00000031557

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084031
AA Change: N222D

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081044
Gene: ENSMUSG00000037406
AA Change: N222D

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IB 37 112 5.44e-7 SMART
KAZAL 109 158 7.92e-4 SMART
Pfam:Trypsin 182 368 5.5e-15 PFAM
Pfam:Trypsin_2 208 346 2.1e-34 PFAM
PDZ 385 470 5.34e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128715
SMART Domains Protein: ENSMUSP00000122564
Gene: ENSMUSG00000031557

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211059
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HtrA family of proteases. The encoded protein contains a putative signal peptide, an insulin growth factor binding domain, a Kazal protease inhibitor domain, a conserved trypsin domain and a PDZ domain. Based on studies on other related family members, this enzyme may function as a secreted oligomeric chaperone protease to degrade misfolded secretory proteins. Other human HtrA proteins have been implicated in arthritis, tumor suppression, unfolded stress response, apoptosis, and aging. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Htra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Htra4 APN 8 25033571 missense probably damaging 0.98
IGL01738:Htra4 APN 8 25025711 missense probably damaging 0.96
IGL02307:Htra4 APN 8 25033694 missense probably damaging 1.00
IGL03382:Htra4 APN 8 25029698 missense probably benign 0.17
R0057:Htra4 UTSW 8 25038808 missense probably benign
R0906:Htra4 UTSW 8 25037144 missense probably benign 0.00
R1075:Htra4 UTSW 8 25033596 missense probably benign 0.00
R1173:Htra4 UTSW 8 25030619 missense possibly damaging 0.92
R1180:Htra4 UTSW 8 25033719 missense probably damaging 1.00
R1854:Htra4 UTSW 8 25033581 missense probably damaging 1.00
R2030:Htra4 UTSW 8 25033577 missense probably damaging 1.00
R2225:Htra4 UTSW 8 25025720 missense probably benign 0.42
R4457:Htra4 UTSW 8 25038658 missense possibly damaging 0.90
R4746:Htra4 UTSW 8 25033697 missense probably damaging 1.00
R4797:Htra4 UTSW 8 25033659 missense probably damaging 1.00
R5369:Htra4 UTSW 8 25033569 missense possibly damaging 0.95
R6846:Htra4 UTSW 8 25030545 missense probably damaging 1.00
R6911:Htra4 UTSW 8 25025705 missense probably damaging 0.96
R7067:Htra4 UTSW 8 25033701 missense probably damaging 1.00
R7367:Htra4 UTSW 8 25033697 missense probably damaging 1.00
R7446:Htra4 UTSW 8 25037165 missense probably benign 0.09
R7603:Htra4 UTSW 8 25025700 missense probably benign 0.03
R7725:Htra4 UTSW 8 25037153 missense possibly damaging 0.94
R7729:Htra4 UTSW 8 25037077 missense possibly damaging 0.63
R7893:Htra4 UTSW 8 25033679 missense possibly damaging 0.81
R7988:Htra4 UTSW 8 25030510 critical splice donor site probably null
R8140:Htra4 UTSW 8 25030558 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCCTCACATGTGAAGGCTCTG -3'
(R):5'- CTCACAAAGCACATGGAAGTGG -3'

Sequencing Primer
(F):5'- TCACATGTGAAGGCTCTGACTCAG -3'
(R):5'- CTGGAAACGTAGCTGATAAACG -3'
Posted On2015-10-08