Mutagenetix > Incidental Mutation

Incidental Mutation 'R0265:Itga1'

34879

Institutional Source

Beutler Lab

Gene Symbol

Itga1

Ensembl Gene

ENSMUSG00000042284

Gene Name

integrin alpha 1

Synonyms

CD49A, Vla1, E130012M19Rik

MMRRC Submission

038491-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.403) question?

Stock #

R0265 (G1)

Quality Score

186

Status

Validated

Chromosome

Chromosomal Location

114953096-115101964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 114992459 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 554 (D554E)

Ref Sequence

ENSEMBL: ENSMUSP00000077132 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061673]

AlphaFold

Q3V3R4

Predicted Effect

probably benign
Transcript: ENSMUST00000061673
AA Change: D554E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: D554E

Domain	Start	End	E-Value	Type
Int_alpha	43	96	1.63e0	SMART
VWA	170	360	4.24e-44	SMART
Int_alpha	432	481	4.21e-3	SMART
Int_alpha	485	542	3.19e-12	SMART
Int_alpha	566	621	1.79e-15	SMART
Int_alpha	628	682	3.04e1	SMART
low complexity region	1108	1122	N/A	INTRINSIC
PDB:2L8S\|A	1135	1179	5e-10	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224865

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.6%
20x: 92.0%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	G	14: 8,431,667	Y655S	probably damaging	Het
9330182L06Rik	T	C	5: 9,434,681	L486P	probably damaging	Het
Abca14	A	G	7: 120,223,627	I321V	probably benign	Het
Adcy7	A	G	8: 88,324,763	D837G	probably damaging	Het
Aldh1a1	T	A	19: 20,640,076	Y457*	probably null	Het
Alox5	T	C	6: 116,420,362	Y287C	probably benign	Het
Ano8	T	C	8: 71,480,524		probably benign	Het
Ap3b1	A	G	13: 94,493,681	K815E	unknown	Het
Atp11a	A	T	8: 12,856,930		probably benign	Het
Atp6v0a1	A	T	11: 101,048,515	D702V	possibly damaging	Het
Cacna1b	T	A	2: 24,761,844	N108Y	probably damaging	Het
Ccdc57	G	C	11: 120,921,811	A39G	probably benign	Het
Cdhr1	A	T	14: 37,081,376	V581D	probably benign	Het
Cyp2b23	A	G	7: 26,672,879		probably benign	Het
D430041D05Rik	G	C	2: 104,167,950	P1836R	probably damaging	Het
Ddit4l	C	T	3: 137,624,287		probably benign	Het
Dnah8	A	T	17: 30,690,271	I1024F	probably benign	Het
Edc3	T	A	9: 57,727,338	F213I	probably damaging	Het
Edrf1	G	A	7: 133,657,045	D717N	probably damaging	Het
Efna5	G	A	17: 62,651,073	P63S	probably damaging	Het
Entpd3	A	G	9: 120,558,481	Y248C	probably damaging	Het
Flcn	G	A	11: 59,795,809	Q373*	probably null	Het
Fry	T	C	5: 150,434,776	V1908A	probably damaging	Het
Gabrg3	A	T	7: 57,381,617	Y58*	probably null	Het
Gabrp	A	T	11: 33,552,614	Y417N	probably damaging	Het
Golga2	C	A	2: 32,304,952		probably null	Het
Grip2	C	A	6: 91,773,792		probably null	Het
Gsx2	A	G	5: 75,077,068	Y227C	probably damaging	Het
Hif3a	T	C	7: 17,035,868	*665W	probably null	Het
Hist1h2aa	T	C	13: 23,934,649	V63A	probably benign	Het
Hsd3b1	C	A	3: 98,852,773	V301L	probably damaging	Het
Ifitm5	T	C	7: 140,950,008		probably benign	Het
Inpp4a	A	T	1: 37,378,986	D498V	probably damaging	Het
Itk	G	A	11: 46,389,458		probably benign	Het
Kdm3b	T	A	18: 34,795,663		probably benign	Het
Klhl6	A	G	16: 19,948,234	V470A	probably benign	Het
Lamb3	T	A	1: 193,320,531	W95R	probably damaging	Het
Lbhd2	T	A	12: 111,410,242	I41N	probably damaging	Het
Lrp4	A	T	2: 91,490,670	S1014C	probably damaging	Het
Ltbp2	C	T	12: 84,785,969		probably null	Het
Map3k19	A	G	1: 127,822,182	I1144T	possibly damaging	Het
Mfsd10	T	C	5: 34,635,163		probably benign	Het
Mocos	A	G	18: 24,666,276	D189G	probably benign	Het
Mvb12a	T	A	8: 71,547,010	F224L	probably damaging	Het
Myo15	A	T	11: 60,514,897		probably null	Het
Nos2	A	T	11: 78,937,602	H249L	probably damaging	Het
Notum	A	G	11: 120,658,334	M184T	probably benign	Het
Nvl	C	A	1: 181,134,830	D192Y	probably damaging	Het
Olfr1024	T	A	2: 85,904,247	N269I	probably benign	Het
Olfr1065	C	A	2: 86,445,959	V8L	probably benign	Het
Olfr1308	T	C	2: 111,960,494	Y193C	probably damaging	Het
Olfr204	A	T	16: 59,315,071	F112Y	probably damaging	Het
Olfr218	A	G	1: 173,203,917	K187R	probably benign	Het
Osgin1	A	G	8: 119,445,657	I397V	possibly damaging	Het
Otulin	A	G	15: 27,616,424	V123A	probably damaging	Het
P4ha1	A	G	10: 59,348,259	Y181C	probably damaging	Het
Pcdhgc5	A	T	18: 37,821,350	D559V	probably damaging	Het
Phf2	T	C	13: 48,828,794	N151S	unknown	Het
Plxnc1	C	A	10: 94,813,129	G1263C	probably benign	Het
Rad51ap1	A	G	6: 126,924,197	*338Q	probably null	Het
Raver1	A	G	9: 21,075,659	S676P	probably benign	Het
Rfx8	T	C	1: 39,688,577	E196G	possibly damaging	Het
Rreb1	A	T	13: 37,916,155	K187*	probably null	Het
Rxfp1	T	C	3: 79,667,654	T217A	probably benign	Het
Rxra	T	C	2: 27,752,430	L305P	probably damaging	Het
Sardh	T	C	2: 27,227,066		probably benign	Het
Skor2	A	T	18: 76,876,598	E952D	probably damaging	Het
Slc22a29	A	T	19: 8,169,970	S343T	probably benign	Het
Sorbs2	T	C	8: 45,785,337		probably benign	Het
Supt7l	C	T	5: 31,515,918	V329I	probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tac1	T	C	6: 7,559,165		probably benign	Het
Tcn2	A	T	11: 3,922,044	V361D	probably damaging	Het
Tm2d3	G	A	7: 65,697,834	A170T	possibly damaging	Het
Tnks	G	A	8: 34,839,970	R1142*	probably null	Het
Ttll7	C	A	3: 146,944,160	Y648*	probably null	Het
Umod	G	T	7: 119,466,073	Q578K	probably benign	Het
Upf2	G	A	2: 6,027,204		probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Washc5	A	G	15: 59,338,960	I1013T	probably benign	Het
Wdr60	T	C	12: 116,257,406		probably benign	Het
Zfp704	C	A	3: 9,565,157	R48L	probably damaging	Het

Other mutations in Itga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Itga1	APN	13	114992363	missense	possibly damaging	0.80
IGL00498:Itga1	APN	13	115031193	missense	probably benign	0.00
IGL00549:Itga1	APN	13	115049296	missense	possibly damaging	0.92
IGL00587:Itga1	APN	13	115012249	missense	probably damaging	1.00
IGL01021:Itga1	APN	13	114997000	missense	probably benign	0.29
IGL01289:Itga1	APN	13	114986226	missense	possibly damaging	0.79
IGL01636:Itga1	APN	13	115006948	missense	possibly damaging	0.73
IGL01791:Itga1	APN	13	114987661	missense	probably benign	0.00
IGL01796:Itga1	APN	13	114985121	missense	probably damaging	1.00
IGL02027:Itga1	APN	13	114990055	splice site	probably null
IGL02330:Itga1	APN	13	115012204	missense	probably damaging	1.00
IGL02480:Itga1	APN	13	114987648	missense	probably damaging	1.00
IGL02943:Itga1	APN	13	115049296	missense	possibly damaging	0.92
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0244:Itga1	UTSW	13	115006897	splice site	probably benign
R0302:Itga1	UTSW	13	115012318	splice site	probably benign
R0320:Itga1	UTSW	13	114977594	splice site	probably benign
R0389:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0443:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0574:Itga1	UTSW	13	114966561	missense	probably damaging	1.00
R0646:Itga1	UTSW	13	114968299	missense	probably benign
R0830:Itga1	UTSW	13	115007032	missense	probably benign	0.08
R2162:Itga1	UTSW	13	115030910	missense	probably benign	0.23
R2216:Itga1	UTSW	13	114997029	missense	probably benign	0.00
R2403:Itga1	UTSW	13	114977614	missense	probably benign	0.00
R3734:Itga1	UTSW	13	114977639	missense	probably benign
R4171:Itga1	UTSW	13	115030886	nonsense	probably null
R4402:Itga1	UTSW	13	115001566	missense	probably benign	0.00
R4675:Itga1	UTSW	13	115001691	splice site	probably null
R4684:Itga1	UTSW	13	115049370	missense	probably damaging	1.00
R4795:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4796:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4845:Itga1	UTSW	13	114974172	nonsense	probably null
R5147:Itga1	UTSW	13	114985142	missense	possibly damaging	0.91
R5155:Itga1	UTSW	13	115035303	missense	probably benign
R5234:Itga1	UTSW	13	115049303	nonsense	probably null
R5344:Itga1	UTSW	13	115002309	missense	possibly damaging	0.78
R5554:Itga1	UTSW	13	114992474	nonsense	probably null
R5662:Itga1	UTSW	13	114986171	missense	probably benign	0.03
R5945:Itga1	UTSW	13	114966590	missense	probably benign	0.02
R6150:Itga1	UTSW	13	114968233	missense	probably benign	0.01
R6241:Itga1	UTSW	13	114960137	splice site	probably null
R6276:Itga1	UTSW	13	114980852	missense	probably benign
R6369:Itga1	UTSW	13	114965660	missense	probably damaging	1.00
R6511:Itga1	UTSW	13	114992501	missense	probably damaging	0.98
R6663:Itga1	UTSW	13	114974105	missense	probably benign	0.02
R6783:Itga1	UTSW	13	114996977	missense	probably benign	0.22
R6931:Itga1	UTSW	13	115001563	missense	probably benign	0.39
R7069:Itga1	UTSW	13	114968240	missense	probably damaging	1.00
R7458:Itga1	UTSW	13	114986266	missense	probably benign	0.00
R7588:Itga1	UTSW	13	114968249	missense	possibly damaging	0.88
R7591:Itga1	UTSW	13	114982779	missense	probably damaging	1.00
R7597:Itga1	UTSW	13	114974140	missense	probably benign	0.28
R7615:Itga1	UTSW	13	114996922	missense	probably null	0.99
R7756:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R7795:Itga1	UTSW	13	115012236	missense	probably damaging	1.00
R7819:Itga1	UTSW	13	115049301	missense	probably damaging	0.99
R8193:Itga1	UTSW	13	114968455	critical splice donor site	probably null
R8313:Itga1	UTSW	13	114966584	missense	probably benign	0.06
R8419:Itga1	UTSW	13	115007068	missense	probably damaging	1.00
R8925:Itga1	UTSW	13	114968519	missense	probably benign	0.01
R8927:Itga1	UTSW	13	114968519	missense	probably benign	0.01
R8951:Itga1	UTSW	13	114970491	nonsense	probably null
R9099:Itga1	UTSW	13	115049320	missense	probably damaging	1.00
R9200:Itga1	UTSW	13	114968461	missense	possibly damaging	0.80
R9221:Itga1	UTSW	13	115030159	nonsense	probably null
R9249:Itga1	UTSW	13	115049298	missense	probably damaging	1.00
R9267:Itga1	UTSW	13	115049388	missense	possibly damaging	0.50
R9376:Itga1	UTSW	13	114970576	missense	probably benign	0.07
R9481:Itga1	UTSW	13	115016217	missense	probably benign	0.34
R9789:Itga1	UTSW	13	115035284	nonsense	probably null
Z1177:Itga1	UTSW	13	114985071	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTTAAAGAGCAAGACAGGTGAGCCC -3'
(R):5'- ACTTCATAAGGTTGGCGAGACGTG -3'

Sequencing Primer
(F):5'- GGCCCTCAAGAAATCTTGGTG -3'
(R):5'- TGCACTTAAAAAACAAACCTACGC -3'

Posted On

2013-05-09