Incidental Mutation 'R4626:Csnk1g2'
ID348791
Institutional Source Beutler Lab
Gene Symbol Csnk1g2
Ensembl Gene ENSMUSG00000003345
Gene Namecasein kinase 1, gamma 2
Synonyms
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4626 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80622838-80640749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80639814 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 405 (A405E)
Ref Sequence ENSEMBL: ENSMUSP00000078706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003434] [ENSMUST00000079773] [ENSMUST00000085435] [ENSMUST00000126980]
Predicted Effect probably benign
Transcript: ENSMUST00000003434
SMART Domains Protein: ENSMUSP00000003434
Gene: ENSMUSG00000003344

DomainStartEndE-ValueType
low complexity region 27 68 N/A INTRINSIC
BTB 115 215 9.96e-25 SMART
BACK 220 328 6.36e-13 SMART
Pfam:PHR 373 522 7.1e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079773
AA Change: A405E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078706
Gene: ENSMUSG00000003345
AA Change: A405E

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Pkinase 126 329 2e-19 PFAM
Pfam:Pkinase_Tyr 128 329 6.2e-10 PFAM
Pfam:CK1gamma_C 382 412 4e-11 PFAM
low complexity region 425 436 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085435
AA Change: A378E

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082560
Gene: ENSMUSG00000003345
AA Change: A378E

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 308 1.3e-14 PFAM
Pfam:Pkinase 46 313 7.6e-35 PFAM
Pfam:CK1gamma_C 354 385 1.2e-11 PFAM
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126980
SMART Domains Protein: ENSMUSP00000120751
Gene: ENSMUSG00000003344

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
BTB 100 200 9.96e-25 SMART
BACK 205 313 6.36e-13 SMART
Pfam:PHR 358 508 4.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131876
SMART Domains Protein: ENSMUSP00000120780
Gene: ENSMUSG00000003344

DomainStartEndE-ValueType
BTB 2 85 4.38e-12 SMART
BACK 90 199 1.21e-13 SMART
PDB:3NO8|B 234 256 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220025
Predicted Effect probably benign
Transcript: ENSMUST00000220163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220431
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Csnk1g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Csnk1g2 APN 10 80634647 unclassified probably benign
IGL01657:Csnk1g2 APN 10 80639629 missense probably benign 0.02
IGL01920:Csnk1g2 APN 10 80638428 missense probably damaging 1.00
IGL02887:Csnk1g2 APN 10 80638535 missense probably damaging 1.00
R2845:Csnk1g2 UTSW 10 80638604 missense probably damaging 1.00
R4135:Csnk1g2 UTSW 10 80638296 missense possibly damaging 0.84
R4717:Csnk1g2 UTSW 10 80637915 missense probably benign 0.36
R4729:Csnk1g2 UTSW 10 80639204 missense probably benign 0.01
R5546:Csnk1g2 UTSW 10 80638398 missense probably benign 0.36
R6000:Csnk1g2 UTSW 10 80638944 missense probably damaging 0.99
R6415:Csnk1g2 UTSW 10 80638296 missense possibly damaging 0.84
R6449:Csnk1g2 UTSW 10 80640072 missense probably damaging 1.00
R7144:Csnk1g2 UTSW 10 80637899 missense probably damaging 1.00
R7263:Csnk1g2 UTSW 10 80634498 missense probably damaging 0.97
R7316:Csnk1g2 UTSW 10 80639853 missense possibly damaging 0.95
R8169:Csnk1g2 UTSW 10 80639802 missense probably damaging 1.00
R8171:Csnk1g2 UTSW 10 80639802 missense probably damaging 1.00
R8227:Csnk1g2 UTSW 10 80638629 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCGCGACAAAGCTCAGCTC -3'
(R):5'- TTGAAGAAGCAGCAGCACC -3'

Sequencing Primer
(F):5'- TCCACACCAAGAACCAGGTGAG -3'
(R):5'- ACCTGCACGGGTGACAAG -3'
Posted On2015-10-08