Incidental Mutation 'R4626:Ap3b1'
ID 348799
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms AP-3, Hps2, beta3A, rim2, recombination induced mutation 2
MMRRC Submission 041891-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R4626 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 94495468-94702825 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 94540586 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 169 (N169K)
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect possibly damaging
Transcript: ENSMUST00000022196
AA Change: N169K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: N169K

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,313,784 (GRCm39) *527G probably null Het
Abca17 A T 17: 24,540,058 (GRCm39) I390N probably damaging Het
Adamts18 C T 8: 114,499,800 (GRCm39) W371* probably null Het
Akr1c13 G T 13: 4,247,869 (GRCm39) V214F probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Ankrd49 A C 9: 14,693,936 (GRCm39) L77R probably damaging Het
Arhgap39 A C 15: 76,621,837 (GRCm39) F255V possibly damaging Het
Atp1a3 T A 7: 24,698,193 (GRCm39) N171I possibly damaging Het
Atp9a T C 2: 168,481,863 (GRCm39) D953G probably damaging Het
Atxn1 T C 13: 45,720,575 (GRCm39) Y440C probably damaging Het
Bccip T C 7: 133,322,457 (GRCm39) Y268H possibly damaging Het
Brms1l C A 12: 55,909,958 (GRCm39) P243T probably benign Het
Btbd10 T C 7: 112,927,605 (GRCm39) E250G probably damaging Het
Cacna1e T C 1: 154,358,294 (GRCm39) probably null Het
Cfhr2 A T 1: 139,741,314 (GRCm39) N220K probably damaging Het
Csnk1g2 C A 10: 80,475,648 (GRCm39) A405E probably damaging Het
D5Ertd579e T C 5: 36,771,903 (GRCm39) I831V possibly damaging Het
F2 T A 2: 91,461,015 (GRCm39) N239I probably benign Het
Fbln5 T A 12: 101,727,086 (GRCm39) D301V probably damaging Het
Fbn2 A T 18: 58,146,819 (GRCm39) C2692* probably null Het
Fhdc1 C T 3: 84,381,557 (GRCm39) D34N probably damaging Het
Galnt13 T A 2: 54,747,878 (GRCm39) M253K probably damaging Het
Gpc6 C A 14: 118,202,255 (GRCm39) Y488* probably null Het
Grm5 G T 7: 87,779,361 (GRCm39) G934C probably damaging Het
Gys1 T C 7: 45,088,958 (GRCm39) L119S probably damaging Het
H2-T15 CTGGGTG CTG 17: 36,368,788 (GRCm39) probably null Het
Htra4 T C 8: 25,527,130 (GRCm39) N222D probably benign Het
Iba57 A G 11: 59,049,287 (GRCm39) V294A probably benign Het
Kctd21 A G 7: 96,996,782 (GRCm39) D85G probably damaging Het
Krt1 C T 15: 101,754,622 (GRCm39) G543S unknown Het
Lama5 G A 2: 179,826,253 (GRCm39) T2330M probably damaging Het
Lrguk G A 6: 34,106,158 (GRCm39) E728K probably benign Het
Mcm6 T C 1: 128,279,285 (GRCm39) D167G probably benign Het
Mettl18 T A 1: 163,824,045 (GRCm39) V122E probably damaging Het
Mindy2 G A 9: 70,534,063 (GRCm39) S378L probably damaging Het
Mis18bp1 G T 12: 65,187,540 (GRCm39) F854L probably damaging Het
Mtdh C T 15: 34,114,980 (GRCm39) R106* probably null Het
Nup214 T A 2: 31,923,416 (GRCm39) V1315E possibly damaging Het
Nup58 A G 14: 60,476,004 (GRCm39) V271A probably benign Het
Or1j1 A G 2: 36,702,271 (GRCm39) Y278H probably damaging Het
Or4c101 T C 2: 88,390,176 (GRCm39) V121A possibly damaging Het
Or6f2 T C 7: 139,756,359 (GRCm39) S109P probably damaging Het
Orc5 G T 5: 22,753,003 (GRCm39) F10L probably benign Het
Pcdha11 A T 18: 37,140,051 (GRCm39) N560I probably damaging Het
Pcdhb9 T A 18: 37,535,302 (GRCm39) F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 (GRCm39) probably benign Het
Poll C A 19: 45,543,563 (GRCm39) M385I probably benign Het
Pomt1 A G 2: 32,144,424 (GRCm39) K737E possibly damaging Het
Prr16 C T 18: 51,435,911 (GRCm39) T130I probably damaging Het
Ptpn18 A G 1: 34,510,873 (GRCm39) probably null Het
Ranbp6 A T 19: 29,788,263 (GRCm39) Y696* probably null Het
Rmi1 A G 13: 58,556,950 (GRCm39) R400G probably benign Het
Scn10a A G 9: 119,460,571 (GRCm39) I1101T possibly damaging Het
Slc22a22 T C 15: 57,126,734 (GRCm39) T93A probably damaging Het
Snx10 A G 6: 51,565,270 (GRCm39) D129G probably damaging Het
Stub1 A G 17: 26,050,845 (GRCm39) probably null Het
Tfr2 T C 5: 137,569,954 (GRCm39) V120A probably benign Het
Trmu T C 15: 85,779,186 (GRCm39) Y278H possibly damaging Het
Ugt2b36 A C 5: 87,239,947 (GRCm39) F146C probably damaging Het
Vav2 T C 2: 27,160,172 (GRCm39) I692V possibly damaging Het
Wdfy3 A G 5: 102,091,800 (GRCm39) L513P probably damaging Het
Zfhx4 T A 3: 5,467,699 (GRCm39) V2619D probably damaging Het
Zfyve26 T A 12: 79,315,844 (GRCm39) N1211Y possibly damaging Het
Zp3r A G 1: 130,542,912 (GRCm39) F142L probably damaging Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94,527,371 (GRCm39) missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94,679,392 (GRCm39) splice site probably benign
IGL01784:Ap3b1 APN 13 94,630,247 (GRCm39) missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94,584,971 (GRCm39) nonsense probably null
IGL02040:Ap3b1 APN 13 94,545,353 (GRCm39) critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94,598,911 (GRCm39) missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94,531,303 (GRCm39) critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94,664,827 (GRCm39) missense unknown
IGL02493:Ap3b1 APN 13 94,540,528 (GRCm39) missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94,554,599 (GRCm39) missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94,613,529 (GRCm39) missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94,664,835 (GRCm39) missense unknown
IGL03033:Ap3b1 APN 13 94,585,003 (GRCm39) missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94,591,906 (GRCm39) missense probably benign 0.00
bella UTSW 13 94,664,765 (GRCm39) missense unknown
bullet_gray UTSW 13 94,587,594 (GRCm39) critical splice donor site probably benign
cuttlefish UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
Gastropod UTSW 13 94,679,348 (GRCm39) missense unknown
razor UTSW 13 94,630,239 (GRCm39) missense unknown
Slime UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
slug UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
snail UTSW 13 94,616,393 (GRCm39) splice site probably benign
stalk UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94,616,393 (GRCm39) splice site probably benign
R0265:Ap3b1 UTSW 13 94,630,189 (GRCm39) missense unknown
R0270:Ap3b1 UTSW 13 94,540,626 (GRCm39) splice site probably benign
R0346:Ap3b1 UTSW 13 94,582,479 (GRCm39) nonsense probably null
R0422:Ap3b1 UTSW 13 94,598,968 (GRCm39) missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94,609,446 (GRCm39) splice site probably benign
R0508:Ap3b1 UTSW 13 94,702,222 (GRCm39) missense unknown
R0764:Ap3b1 UTSW 13 94,616,387 (GRCm39) splice site probably benign
R1506:Ap3b1 UTSW 13 94,582,651 (GRCm39) splice site probably benign
R1593:Ap3b1 UTSW 13 94,638,435 (GRCm39) missense unknown
R1660:Ap3b1 UTSW 13 94,545,320 (GRCm39) missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94,630,225 (GRCm39) missense unknown
R1791:Ap3b1 UTSW 13 94,545,305 (GRCm39) missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94,608,212 (GRCm39) missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94,664,724 (GRCm39) missense unknown
R3031:Ap3b1 UTSW 13 94,702,151 (GRCm39) missense unknown
R3037:Ap3b1 UTSW 13 94,582,486 (GRCm39) critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94,702,243 (GRCm39) missense unknown
R4624:Ap3b1 UTSW 13 94,619,734 (GRCm39) missense unknown
R4754:Ap3b1 UTSW 13 94,540,468 (GRCm39) missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94,702,149 (GRCm39) missense unknown
R4847:Ap3b1 UTSW 13 94,608,287 (GRCm39) missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94,609,313 (GRCm39) missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94,616,357 (GRCm39) missense unknown
R5628:Ap3b1 UTSW 13 94,613,556 (GRCm39) missense unknown
R5671:Ap3b1 UTSW 13 94,664,765 (GRCm39) missense unknown
R5677:Ap3b1 UTSW 13 94,664,704 (GRCm39) missense unknown
R5862:Ap3b1 UTSW 13 94,684,278 (GRCm39) missense unknown
R5941:Ap3b1 UTSW 13 94,619,773 (GRCm39) missense probably damaging 0.96
R5941:Ap3b1 UTSW 13 94,576,781 (GRCm39) missense probably benign 0.02
R6043:Ap3b1 UTSW 13 94,613,501 (GRCm39) missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94,630,207 (GRCm39) missense unknown
R6212:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R6301:Ap3b1 UTSW 13 94,664,803 (GRCm39) missense unknown
R6765:Ap3b1 UTSW 13 94,599,017 (GRCm39) missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94,616,369 (GRCm39) missense unknown
R6888:Ap3b1 UTSW 13 94,545,299 (GRCm39) missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94,554,650 (GRCm39) missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94,668,542 (GRCm39) nonsense probably null
R7422:Ap3b1 UTSW 13 94,664,673 (GRCm39) missense unknown
R7642:Ap3b1 UTSW 13 94,613,540 (GRCm39) missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94,664,666 (GRCm39) splice site probably null
R7867:Ap3b1 UTSW 13 94,619,771 (GRCm39) missense unknown
R8492:Ap3b1 UTSW 13 94,531,294 (GRCm39) missense possibly damaging 0.60
R8706:Ap3b1 UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94,664,725 (GRCm39) missense unknown
R8876:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R8889:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R8892:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R9065:Ap3b1 UTSW 13 94,608,223 (GRCm39) missense probably damaging 1.00
R9152:Ap3b1 UTSW 13 94,630,239 (GRCm39) missense unknown
R9152:Ap3b1 UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R9166:Ap3b1 UTSW 13 94,608,236 (GRCm39) missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94,540,570 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAGGTGTCTCTGGAAATG -3'
(R):5'- CCTGGGAGATCTGCTCTTTTAC -3'

Sequencing Primer
(F):5'- TGCAGGTGTCTCTGGAAATGTAAAC -3'
(R):5'- GGGAGATCTGCTCTTTTACTTAAAG -3'
Posted On 2015-10-08