Incidental Mutation 'R4626:Nupl1'
ID348800
Institutional Source Beutler Lab
Gene Symbol Nupl1
Ensembl Gene ENSMUSG00000063895
Gene Namenucleoporin like 1
Synonyms1700017F11Rik
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R4626 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location60184612-60251431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60238555 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 271 (V271A)
Ref Sequence ENSEMBL: ENSMUSP00000153642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041905] [ENSMUST00000225111] [ENSMUST00000225311] [ENSMUST00000225805]
Predicted Effect probably benign
Transcript: ENSMUST00000041905
AA Change: V271A

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038716
Gene: ENSMUSG00000114797
AA Change: V271A

DomainStartEndE-ValueType
Pfam:Nucleoporin_FG2 3 587 1.5e-299 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224575
Predicted Effect probably benign
Transcript: ENSMUST00000225111
AA Change: V271A

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000225311
AA Change: V271A

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225572
Predicted Effect probably benign
Transcript: ENSMUST00000225805
AA Change: V271A

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleoporin family that shares 87% sequence identity with rat nucleoporin p58. The protein is localized to the nuclear rim and is a component of the nuclear pore complex (NPC). All molecules entering or leaving the nucleus either diffuse through or are actively transported by the NPC. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Nupl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nupl1 APN 14 60242577 missense probably benign 0.01
IGL00693:Nupl1 APN 14 60238520 missense probably benign 0.10
IGL00725:Nupl1 APN 14 60243440 missense possibly damaging 0.84
IGL00969:Nupl1 APN 14 60228916 splice site probably benign
IGL03243:Nupl1 APN 14 60221616 missense probably benign 0.06
IGL03351:Nupl1 APN 14 60228775 missense probably benign 0.19
R0056:Nupl1 UTSW 14 60239475 splice site probably null
R0113:Nupl1 UTSW 14 60251291 start gained probably benign
R0201:Nupl1 UTSW 14 60244616 missense probably benign 0.32
R0830:Nupl1 UTSW 14 60243482 missense probably damaging 1.00
R0925:Nupl1 UTSW 14 60220141 missense probably damaging 0.99
R1004:Nupl1 UTSW 14 60247481 splice site probably benign
R1178:Nupl1 UTSW 14 60244670 splice site probably benign
R1181:Nupl1 UTSW 14 60244670 splice site probably benign
R1268:Nupl1 UTSW 14 60244670 splice site probably benign
R1388:Nupl1 UTSW 14 60244670 splice site probably benign
R1411:Nupl1 UTSW 14 60244670 splice site probably benign
R1442:Nupl1 UTSW 14 60232543 splice site probably benign
R1626:Nupl1 UTSW 14 60242627 nonsense probably null
R1697:Nupl1 UTSW 14 60244670 splice site probably benign
R1756:Nupl1 UTSW 14 60244670 splice site probably benign
R1853:Nupl1 UTSW 14 60244547 missense possibly damaging 0.81
R1915:Nupl1 UTSW 14 60238531 missense probably benign 0.00
R2160:Nupl1 UTSW 14 60239508 missense probably benign 0.15
R2211:Nupl1 UTSW 14 60232640 missense probably damaging 0.99
R2213:Nupl1 UTSW 14 60239496 missense probably benign 0.01
R2518:Nupl1 UTSW 14 60232660 missense probably damaging 1.00
R2519:Nupl1 UTSW 14 60223359 missense probably benign 0.23
R3914:Nupl1 UTSW 14 60232147 missense possibly damaging 0.76
R4302:Nupl1 UTSW 14 60247426 missense probably benign 0.44
R4705:Nupl1 UTSW 14 60251215 missense unknown
R4772:Nupl1 UTSW 14 60220022 missense probably benign 0.00
R6151:Nupl1 UTSW 14 60244616 missense possibly damaging 0.71
R6187:Nupl1 UTSW 14 60240807 splice site probably null
R6546:Nupl1 UTSW 14 60223223 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTCTTAATAGCATGTAAATACCAAAC -3'
(R):5'- AACGTTTTAAATCCTGGTCTCTTTGTT -3'

Sequencing Primer
(F):5'- TTCAGGAGCTCCCCCAC -3'
(R):5'- CTGATCCTTGGCTTCTGCTAGAG -3'
Posted On2015-10-08