Incidental Mutation 'R4626:Arhgap39'
ID348804
Institutional Source Beutler Lab
Gene Symbol Arhgap39
Ensembl Gene ENSMUSG00000033697
Gene NameRho GTPase activating protein 39
SynonymsD15Wsu169e
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R4626 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76723985-76818170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 76737637 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 255 (F255V)
Ref Sequence ENSEMBL: ENSMUSP00000036697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036176] [ENSMUST00000077821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036176
AA Change: F255V

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036697
Gene: ENSMUSG00000033697
AA Change: F255V

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 759 904 2.3e-32 PFAM
RhoGAP 932 1105 5.9e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077821
AA Change: F255V

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000076993
Gene: ENSMUSG00000033697
AA Change: F255V

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 756 874 3.3e-25 PFAM
RhoGAP 901 1074 5.9e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177011
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Arhgap39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Arhgap39 APN 15 76737815 splice site probably benign
IGL01586:Arhgap39 APN 15 76730438 missense probably benign 0.16
IGL01693:Arhgap39 APN 15 76725967 missense probably null 1.00
IGL02017:Arhgap39 APN 15 76737037 missense probably damaging 0.98
IGL02508:Arhgap39 APN 15 76724984 makesense probably null
IGL03333:Arhgap39 APN 15 76726732 missense probably benign 0.05
R0328:Arhgap39 UTSW 15 76751952 splice site probably benign
R0432:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0479:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0549:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0551:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R1054:Arhgap39 UTSW 15 76751559 missense probably benign
R1830:Arhgap39 UTSW 15 76735183 missense probably damaging 1.00
R2421:Arhgap39 UTSW 15 76725146 missense probably damaging 1.00
R2497:Arhgap39 UTSW 15 76725385 missense probably damaging 1.00
R3909:Arhgap39 UTSW 15 76751888 missense probably benign 0.03
R4410:Arhgap39 UTSW 15 76725512 unclassified probably benign
R4790:Arhgap39 UTSW 15 76726731 missense possibly damaging 0.51
R4792:Arhgap39 UTSW 15 76741517 missense possibly damaging 0.92
R4911:Arhgap39 UTSW 15 76737805 missense probably damaging 1.00
R5225:Arhgap39 UTSW 15 76725515 unclassified probably benign
R5417:Arhgap39 UTSW 15 76735101 missense possibly damaging 0.80
R5443:Arhgap39 UTSW 15 76797925 intron probably benign
R5521:Arhgap39 UTSW 15 76765494 missense possibly damaging 0.66
R5686:Arhgap39 UTSW 15 76726633 missense probably damaging 1.00
R5747:Arhgap39 UTSW 15 76741535 missense possibly damaging 0.68
R5785:Arhgap39 UTSW 15 76737418 missense probably benign
R5879:Arhgap39 UTSW 15 76751807 missense probably damaging 1.00
R6035:Arhgap39 UTSW 15 76737224 nonsense probably null
R6035:Arhgap39 UTSW 15 76737224 nonsense probably null
R6049:Arhgap39 UTSW 15 76727401 critical splice donor site probably null
R6143:Arhgap39 UTSW 15 76730406 nonsense probably null
R6232:Arhgap39 UTSW 15 76736512 missense probably damaging 1.00
R6276:Arhgap39 UTSW 15 76737536 missense probably benign 0.06
R6277:Arhgap39 UTSW 15 76735137 missense probably damaging 1.00
R6305:Arhgap39 UTSW 15 76737702 missense probably benign 0.31
R6587:Arhgap39 UTSW 15 76737499 missense probably damaging 1.00
R7153:Arhgap39 UTSW 15 76765491 missense probably benign 0.09
R7447:Arhgap39 UTSW 15 76765597 start gained probably benign
R7658:Arhgap39 UTSW 15 76737417 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AATAGGGGCCTGGTATTCCAC -3'
(R):5'- AGTGACTGGATGTCCTCTCTCC -3'

Sequencing Primer
(F):5'- TATTCCACTGGAGGCTCCTCATAGAG -3'
(R):5'- GGATGTCCTCTCTCCACATAGGAC -3'
Posted On2015-10-08