Mutagenetix > Incidental Mutations

Incidental Mutation 'R4626:Arhgap39'

348804

Institutional Source

Beutler Lab

Gene Symbol

Arhgap39

Ensembl Gene

ENSMUSG00000033697

Gene Name

Rho GTPase activating protein 39

Synonyms

D15Wsu169e

MMRRC Submission

041891-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R4626 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76723985-76818170 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 76737637 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 255 (F255V)

Ref Sequence

ENSEMBL: ENSMUSP00000036697 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036176] [ENSMUST00000077821]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036176
AA Change: F255V

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000036697
Gene: ENSMUSG00000033697
AA Change: F255V

Domain	Start	End	E-Value	Type
WW	27	60	1.64e0	SMART
WW	66	99	5.41e-1	SMART
low complexity region	125	138	N/A	INTRINSIC
low complexity region	304	318	N/A	INTRINSIC
Pfam:MyTH4	759	904	2.3e-32	PFAM
RhoGAP	932	1105	5.9e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000077821
AA Change: F255V

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000076993
Gene: ENSMUSG00000033697
AA Change: F255V

Domain	Start	End	E-Value	Type
WW	27	60	1.64e0	SMART
WW	66	99	5.41e-1	SMART
low complexity region	125	138	N/A	INTRINSIC
low complexity region	304	318	N/A	INTRINSIC
Pfam:MyTH4	756	874	3.3e-25	PFAM
RhoGAP	901	1074	5.9e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177011

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatf	A	C	11: 84,422,958	*527G	probably null	Het
Abca17	A	T	17: 24,321,084	I390N	probably damaging	Het
Adamts18	C	T	8: 113,773,168	W371*	probably null	Het
Akr1c13	G	T	13: 4,197,870	V214F	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ankrd49	A	C	9: 14,782,640	L77R	probably damaging	Het
Ap3b1	T	A	13: 94,404,078	N169K	possibly damaging	Het
Atp1a3	T	A	7: 24,998,768	N171I	possibly damaging	Het
Atp9a	T	C	2: 168,639,943	D953G	probably damaging	Het
Atxn1	T	C	13: 45,567,099	Y440C	probably damaging	Het
Bccip	T	C	7: 133,720,728	Y268H	possibly damaging	Het
Brms1l	C	A	12: 55,863,173	P243T	probably benign	Het
Btbd10	T	C	7: 113,328,398	E250G	probably damaging	Het
Cacna1e	T	C	1: 154,482,548		probably null	Het
Cfhr2	A	T	1: 139,813,576	N220K	probably damaging	Het
Csnk1g2	C	A	10: 80,639,814	A405E	probably damaging	Het
D5Ertd579e	T	C	5: 36,614,559	I831V	possibly damaging	Het
F2	T	A	2: 91,630,670	N239I	probably benign	Het
Fbln5	T	A	12: 101,760,827	D301V	probably damaging	Het
Fbn2	A	T	18: 58,013,747	C2692*	probably null	Het
Fhdc1	C	T	3: 84,474,250	D34N	probably damaging	Het
Galnt13	T	A	2: 54,857,866	M253K	probably damaging	Het
Gm11127	CTGGGTG	CTG	17: 36,057,896		probably null	Het
Gpc6	C	A	14: 117,964,843	Y488*	probably null	Het
Grm5	G	T	7: 88,130,153	G934C	probably damaging	Het
Gys1	T	C	7: 45,439,534	L119S	probably damaging	Het
Htra4	T	C	8: 25,037,114	N222D	probably benign	Het
Iba57	A	G	11: 59,158,461	V294A	probably benign	Het
Kctd21	A	G	7: 97,347,575	D85G	probably damaging	Het
Krt1	C	T	15: 101,846,187	G543S	unknown	Het
Lama5	G	A	2: 180,184,460	T2330M	probably damaging	Het
Lrguk	G	A	6: 34,129,223	E728K	probably benign	Het
Mcm6	T	C	1: 128,351,548	D167G	probably benign	Het
Mettl18	T	A	1: 163,996,476	V122E	probably damaging	Het
Mindy2	G	A	9: 70,626,781	S378L	probably damaging	Het
Mis18bp1	G	T	12: 65,140,766	F854L	probably damaging	Het
Mtdh	C	T	15: 34,114,834	R106*	probably null	Het
Nup214	T	A	2: 32,033,404	V1315E	possibly damaging	Het
Nupl1	A	G	14: 60,238,555	V271A	probably benign	Het
Olfr1188	T	C	2: 88,559,832	V121A	possibly damaging	Het
Olfr3	A	G	2: 36,812,259	Y278H	probably damaging	Het
Olfr523	T	C	7: 140,176,446	S109P	probably damaging	Het
Orc5	G	T	5: 22,548,005	F10L	probably benign	Het
Pcdha11	A	T	18: 37,006,998	N560I	probably damaging	Het
Pcdhb9	T	A	18: 37,402,249	F432Y	probably benign	Het
Peg10	GGATCC	GGATCCCCATCAAGATCC	6: 4,756,460		probably benign	Het
Poll	C	A	19: 45,555,124	M385I	probably benign	Het
Pomt1	A	G	2: 32,254,412	K737E	possibly damaging	Het
Prr16	C	T	18: 51,302,839	T130I	probably damaging	Het
Ptpn18	A	G	1: 34,471,792		probably null	Het
Ranbp6	A	T	19: 29,810,863	Y696*	probably null	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Scn10a	A	G	9: 119,631,505	I1101T	possibly damaging	Het
Slc22a22	T	C	15: 57,263,338	T93A	probably damaging	Het
Snx10	A	G	6: 51,588,290	D129G	probably damaging	Het
Stub1	A	G	17: 25,831,871		probably null	Het
Tfr2	T	C	5: 137,571,692	V120A	probably benign	Het
Trmu	T	C	15: 85,894,985	Y278H	possibly damaging	Het
Ugt2b36	A	C	5: 87,092,088	F146C	probably damaging	Het
Vav2	T	C	2: 27,270,160	I692V	possibly damaging	Het
Wdfy3	A	G	5: 101,943,934	L513P	probably damaging	Het
Zfhx4	T	A	3: 5,402,639	V2619D	probably damaging	Het
Zfyve26	T	A	12: 79,269,070	N1211Y	possibly damaging	Het
Zp3r	A	G	1: 130,615,175	F142L	probably damaging	Het

Other mutations in Arhgap39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01547:Arhgap39	APN	15	76737815	splice site	probably benign
IGL01586:Arhgap39	APN	15	76730438	missense	probably benign	0.16
IGL01693:Arhgap39	APN	15	76725967	missense	probably null	1.00
IGL02017:Arhgap39	APN	15	76737037	missense	probably damaging	0.98
IGL02508:Arhgap39	APN	15	76724984	makesense	probably null
IGL03333:Arhgap39	APN	15	76726732	missense	probably benign	0.05
R0328:Arhgap39	UTSW	15	76751952	splice site	probably benign
R0432:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0479:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0549:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0551:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R1054:Arhgap39	UTSW	15	76751559	missense	probably benign
R1830:Arhgap39	UTSW	15	76735183	missense	probably damaging	1.00
R2421:Arhgap39	UTSW	15	76725146	missense	probably damaging	1.00
R2497:Arhgap39	UTSW	15	76725385	missense	probably damaging	1.00
R3909:Arhgap39	UTSW	15	76751888	missense	probably benign	0.03
R4410:Arhgap39	UTSW	15	76725512	unclassified	probably benign
R4790:Arhgap39	UTSW	15	76726731	missense	possibly damaging	0.51
R4792:Arhgap39	UTSW	15	76741517	missense	possibly damaging	0.92
R4911:Arhgap39	UTSW	15	76737805	missense	probably damaging	1.00
R5225:Arhgap39	UTSW	15	76725515	unclassified	probably benign
R5417:Arhgap39	UTSW	15	76735101	missense	possibly damaging	0.80
R5443:Arhgap39	UTSW	15	76797925	intron	probably benign
R5521:Arhgap39	UTSW	15	76765494	missense	possibly damaging	0.66
R5686:Arhgap39	UTSW	15	76726633	missense	probably damaging	1.00
R5747:Arhgap39	UTSW	15	76741535	missense	possibly damaging	0.68
R5785:Arhgap39	UTSW	15	76737418	missense	probably benign
R5879:Arhgap39	UTSW	15	76751807	missense	probably damaging	1.00
R6035:Arhgap39	UTSW	15	76737224	nonsense	probably null
R6035:Arhgap39	UTSW	15	76737224	nonsense	probably null
R6049:Arhgap39	UTSW	15	76727401	critical splice donor site	probably null
R6143:Arhgap39	UTSW	15	76730406	nonsense	probably null
R6232:Arhgap39	UTSW	15	76736512	missense	probably damaging	1.00
R6276:Arhgap39	UTSW	15	76737536	missense	probably benign	0.06
R6277:Arhgap39	UTSW	15	76735137	missense	probably damaging	1.00
R6305:Arhgap39	UTSW	15	76737702	missense	probably benign	0.31
R6587:Arhgap39	UTSW	15	76737499	missense	probably damaging	1.00
R7153:Arhgap39	UTSW	15	76765491	missense	probably benign	0.09
R7447:Arhgap39	UTSW	15	76765597	start gained	probably benign
R7658:Arhgap39	UTSW	15	76737417	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AATAGGGGCCTGGTATTCCAC -3'
(R):5'- AGTGACTGGATGTCCTCTCTCC -3'

Sequencing Primer
(F):5'- TATTCCACTGGAGGCTCCTCATAGAG -3'
(R):5'- GGATGTCCTCTCTCCACATAGGAC -3'

Posted On

2015-10-08