Incidental Mutation 'R4626:Trmu'
ID348805
Institutional Source Beutler Lab
Gene Symbol Trmu
Ensembl Gene ENSMUSG00000022386
Gene NametRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Synonyms1600025P05Rik, Trmt1, 1110005N20Rik
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R4626 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85879312-85897394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85894985 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 278 (Y278H)
Ref Sequence ENSEMBL: ENSMUSP00000023019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172] [ENSMUST00000023019] [ENSMUST00000162491]
Predicted Effect probably benign
Transcript: ENSMUST00000016172
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000023019
AA Change: Y278H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023019
Gene: ENSMUSG00000022386
AA Change: Y278H

DomainStartEndE-ValueType
Pfam:NAD_synthase 1 133 7.7e-7 PFAM
Pfam:ThiI 3 79 7.7e-8 PFAM
Pfam:tRNA_Me_trans 5 383 3.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162010
Predicted Effect probably benign
Transcript: ENSMUST00000162339
SMART Domains Protein: ENSMUSP00000125266
Gene: ENSMUSG00000022386

DomainStartEndE-ValueType
Pfam:tRNA_Me_trans 1 46 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162491
SMART Domains Protein: ENSMUSP00000125704
Gene: ENSMUSG00000022386

DomainStartEndE-ValueType
Pfam:NAD_synthase 1 88 1.1e-8 PFAM
Pfam:Asn_synthase 1 90 3e-7 PFAM
Pfam:ThiI 3 84 1.6e-10 PFAM
Pfam:tRNA_Me_trans 5 88 2.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162601
Predicted Effect probably benign
Transcript: ENSMUST00000226840
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a mitochondrial tRNA-modifying enzyme. The encoded protein catalyzes the 2-thiolation of uridine on the wobble positions of tRNA(Lys), tRNA(Glu), and tRNA(Gln), resulting in the formation of 5-taurinomethyl-2-thiouridine moieties. Mutations in this gene may cause transient infantile liver failure. Polymorphisms in this gene may also influence the severity of deafness caused by mitochondrial 12S ribosomal RNA mutations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous KO is embryonic lethal. Homozygous conditional KO in the liver affects mitochondrial function owing to impaired mt-tRNA modifications. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Trmu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Trmu APN 15 85882831 missense probably benign 0.00
IGL02873:Trmu APN 15 85896832 splice site probably null
IGL03375:Trmu APN 15 85894937 missense possibly damaging 0.65
R0592:Trmu UTSW 15 85896826 unclassified probably benign
R0781:Trmu UTSW 15 85879403 nonsense probably null
R1120:Trmu UTSW 15 85890285 missense possibly damaging 0.75
R1165:Trmu UTSW 15 85892674 missense probably damaging 0.99
R1443:Trmu UTSW 15 85897101 splice site probably null
R1503:Trmu UTSW 15 85895019 missense possibly damaging 0.88
R4790:Trmu UTSW 15 85882805 missense probably damaging 1.00
R5134:Trmu UTSW 15 85896355 splice site probably null
R5399:Trmu UTSW 15 85896408 splice site probably null
R5639:Trmu UTSW 15 85882698 missense probably damaging 1.00
R6831:Trmu UTSW 15 85895006 missense probably benign
R8093:Trmu UTSW 15 85882720 missense probably benign 0.08
R8276:Trmu UTSW 15 85882731 missense possibly damaging 0.88
RF007:Trmu UTSW 15 85892569 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGTCACTGTCACATCCCTCGAG -3'
(R):5'- TCTCACAGGAGCCTAGTGAG -3'

Sequencing Primer
(F):5'- CTCGAGACCTGAAGCCAAGG -3'
(R):5'- CAGGAGCCTAGTGAGCACTTTATATG -3'
Posted On2015-10-08