Incidental Mutation 'R4626:Gm11127'
ID348809
Institutional Source Beutler Lab
Gene Symbol Gm11127
Ensembl Gene ENSMUSG00000079492
Gene Namepredicted gene 11127
Synonyms
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4626 (G1)
Quality Score217
Status Not validated
Chromosome17
Chromosomal Location36055816-36058371 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTGGGTG to CTG at 36057896 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097331] [ENSMUST00000113742]
Predicted Effect probably benign
Transcript: ENSMUST00000097331
SMART Domains Protein: ENSMUSP00000094943
Gene: ENSMUSG00000073407

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113742
SMART Domains Protein: ENSMUSP00000109371
Gene: ENSMUSG00000079492

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 6.4e-81 PFAM
IGc1 220 291 2.53e-23 SMART
transmembrane domain 306 328 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Gm11127
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01859:Gm11127 APN 17 36058011 missense possibly damaging 0.78
IGL02007:Gm11127 APN 17 36056330 missense possibly damaging 0.50
R1075:Gm11127 UTSW 17 36056146 missense probably benign 0.05
R1829:Gm11127 UTSW 17 36058004 missense probably damaging 1.00
R1944:Gm11127 UTSW 17 36058005 missense probably damaging 1.00
R4117:Gm11127 UTSW 17 36057604 missense probably damaging 1.00
R4584:Gm11127 UTSW 17 36057667 missense probably damaging 1.00
R4649:Gm11127 UTSW 17 36057876 missense possibly damaging 0.90
R4864:Gm11127 UTSW 17 36058361 utr 3 prime probably benign
R5412:Gm11127 UTSW 17 36056044 missense probably benign 0.01
R5430:Gm11127 UTSW 17 36056075 missense probably benign 0.00
R5547:Gm11127 UTSW 17 36057904 missense possibly damaging 0.63
R5896:Gm11127 UTSW 17 36056344 missense probably benign 0.01
R5974:Gm11127 UTSW 17 36056785 missense probably benign 0.05
R6456:Gm11127 UTSW 17 36056610 missense probably damaging 1.00
R7073:Gm11127 UTSW 17 36058343 missense unknown
R7217:Gm11127 UTSW 17 36056343 missense probably benign 0.01
R7652:Gm11127 UTSW 17 36056783 missense probably damaging 1.00
R8267:Gm11127 UTSW 17 36056783 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ATCCGTGCATATCCTGGATTGTG -3'
(R):5'- TTCGCCACTGCCATATCCAG -3'

Sequencing Primer
(F):5'- CCCATGTTCAGGCACAGTC -3'
(R):5'- ATATCCAGGCCAGGCTTCG -3'
Posted On2015-10-08