Incidental Mutation 'R4626:Poll'
ID348816
Institutional Source Beutler Lab
Gene Symbol Poll
Ensembl Gene ENSMUSG00000025218
Gene Namepolymerase (DNA directed), lambda
Synonyms
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4626 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location45552275-45560531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45555124 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 385 (M385I)
Ref Sequence ENSEMBL: ENSMUSP00000026239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026239]
Predicted Effect probably benign
Transcript: ENSMUST00000026239
AA Change: M385I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000026239
Gene: ENSMUSG00000025218
AA Change: M385I

DomainStartEndE-ValueType
PDB:2JW5|A 35 134 4e-35 PDB
Blast:BRCT 39 121 5e-32 BLAST
low complexity region 220 233 N/A INTRINSIC
POLXc 249 572 2.71e-79 SMART
HhH1 295 314 3.11e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA polymerase. DNA polymerases catalyze DNA-template-directed extension of the 3'-end of a DNA strand. This particular polymerase, which is a member of the X family of DNA polymerases, likely plays a role in non-homologous end joining and other DNA repair processes. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective heavy chain rearrangement. See also the Dpcd gene for mutations that affect both of these overlapping genes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbln5 T A 12: 101,760,827 D301V probably damaging Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Poll
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Poll APN 19 45553601 missense probably damaging 0.99
IGL01369:Poll APN 19 45553676 missense probably damaging 1.00
R0308:Poll UTSW 19 45555965 missense probably damaging 1.00
R0374:Poll UTSW 19 45557870 missense probably benign 0.21
R2090:Poll UTSW 19 45558838 missense probably benign 0.24
R3721:Poll UTSW 19 45553577 missense probably damaging 0.99
R3938:Poll UTSW 19 45558418 unclassified probably benign
R4171:Poll UTSW 19 45556053 missense probably damaging 1.00
R5990:Poll UTSW 19 45553155 missense possibly damaging 0.91
R6090:Poll UTSW 19 45555997 missense probably benign
R6433:Poll UTSW 19 45553604 missense probably benign 0.00
R7023:Poll UTSW 19 45558838 missense probably benign
R7436:Poll UTSW 19 45553057 missense probably damaging 1.00
R8221:Poll UTSW 19 45553608 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTTCATGCTTAGTGACCCTG -3'
(R):5'- TCTGTCTTCCATGGCAGCTG -3'

Sequencing Primer
(F):5'- ATGCTTAGTGACCCTGAGACCAG -3'
(R):5'- ATGGCAGCTGCTGTGACAG -3'
Posted On2015-10-08