Incidental Mutation 'R4627:Lmbrd1'
ID348818
Institutional Source Beutler Lab
Gene Symbol Lmbrd1
Ensembl Gene ENSMUSG00000073725
Gene NameLMBR1 domain containing 1
Synonyms0910001K20Rik
MMRRC Submission 041892-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4627 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location24678630-24766301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24705999 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 140 (Y140C)
Ref Sequence ENSEMBL: ENSMUSP00000140783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095062] [ENSMUST00000186096] [ENSMUST00000186190] [ENSMUST00000191471]
Predicted Effect probably damaging
Transcript: ENSMUST00000095062
AA Change: Y70C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092672
Gene: ENSMUSG00000073725
AA Change: Y70C

DomainStartEndE-ValueType
Pfam:LMBR1 17 292 3e-24 PFAM
transmembrane domain 303 325 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
low complexity region 522 531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186096
AA Change: Y140C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140911
Gene: ENSMUSG00000073725
AA Change: Y140C

DomainStartEndE-ValueType
Pfam:LMBR1 12 155 2.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186190
SMART Domains Protein: ENSMUSP00000139893
Gene: ENSMUSG00000073725

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191471
AA Change: Y140C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140783
Gene: ENSMUSG00000073725
AA Change: Y140C

DomainStartEndE-ValueType
Pfam:LMBR1 12 289 2.7e-19 PFAM
transmembrane domain 303 325 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
low complexity region 522 531 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal membrane protein that may be involved in the transport and metabolism of cobalamin. This protein also interacts with the large form of the hepatitis delta antigen and may be required for the nucleocytoplasmic shuttling of the hepatitis delta virus. Mutations in this gene are associated with the vitamin B12 metabolism disorder termed, homocystinuria-megaloblastic anemia complementation type F.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice heterozygous for a targeted allele exhibit increased cardiac cell glucose uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Adam6a A T 12: 113,544,949 D314V probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Adamtsl2 T A 2: 27,093,585 L331Q probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Aldoart1 T C 4: 72,852,443 T43A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ano7 T C 1: 93,375,185 I15T probably benign Het
Aox3 A T 1: 58,125,035 T155S probably damaging Het
Ap2a1 C T 7: 44,904,419 V535M probably damaging Het
Apbb2 C T 5: 66,400,076 probably null Het
Astn1 C A 1: 158,502,251 H225Q possibly damaging Het
Atm A G 9: 53,456,506 I2439T possibly damaging Het
Atp1b2 T A 11: 69,601,334 I263F probably damaging Het
Ccdc184 A T 15: 98,168,757 N148Y probably benign Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Cep192 C G 18: 67,812,369 P180R probably benign Het
Cfap46 T C 7: 139,657,281 Y571C probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chchd6 G A 6: 89,384,660 L226F probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cobl T C 11: 12,251,093 E1214G probably damaging Het
Cpsf2 G A 12: 101,989,895 R319Q probably benign Het
Csdc2 T C 15: 81,949,123 V107A probably benign Het
Csmd1 A G 8: 16,697,917 W273R probably benign Het
Diexf T C 1: 193,107,695 T719A probably benign Het
Dnah2 T A 11: 69,465,376 N2156I probably damaging Het
Dsp A G 13: 38,168,641 Y165C probably benign Het
Exoc1 T C 5: 76,542,228 V205A probably benign Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fbln2 G T 6: 91,259,767 V755L probably damaging Het
Fhad1 A T 4: 141,896,468 V1371D possibly damaging Het
Folh1 A T 7: 86,773,252 M59K probably benign Het
Foxf2 A T 13: 31,626,888 H270L probably benign Het
Gm14401 G A 2: 177,086,316 R65H probably benign Het
Gpn1 C A 5: 31,498,393 Y592* probably null Het
Hmcn1 T G 1: 150,595,894 D4903A probably benign Het
Hnf1a T C 5: 114,955,871 R220G probably damaging Het
Hoxd10 G A 2: 74,692,292 A105T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 C T 12: 25,057,042 T1498I possibly damaging Het
Klhl2 G T 8: 64,758,191 Y274* probably null Het
Mapk8ip3 G A 17: 24,903,293 T706I probably benign Het
Mast4 A C 13: 103,334,021 S58A possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mmachc A T 4: 116,703,471 S276T probably damaging Het
Nfat5 A T 8: 107,369,276 Q1289L probably damaging Het
Nlrc4 G T 17: 74,446,628 F253L probably damaging Het
Nr1i3 C A 1: 171,216,445 A112E probably benign Het
Olfr1367 T C 13: 21,347,464 F179L probably damaging Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr455 T A 6: 42,538,441 T194S possibly damaging Het
Olfr853 G T 9: 19,537,673 Q86K possibly damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pde10a A C 17: 8,981,652 D779A probably damaging Het
Pde4b T C 4: 102,601,605 L486S probably damaging Het
Pex2 A T 3: 5,561,281 I156N probably damaging Het
Phtf2 C T 5: 20,773,740 R63Q probably damaging Het
Prag1 A G 8: 36,103,292 Y343C probably damaging Het
Prdm16 A T 4: 154,367,240 Y170N probably damaging Het
Prpf6 A C 2: 181,601,474 K5T probably damaging Het
Ptpn1 A G 2: 167,967,781 K103R probably benign Het
Ralgapa2 A G 2: 146,361,453 S1159P possibly damaging Het
Rapgef3 G T 15: 97,758,929 D318E probably damaging Het
Ripk4 A T 16: 97,744,026 S474T probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Sec16a A G 2: 26,429,393 V1491A probably damaging Het
Sec16a C T 2: 26,431,068 probably null Het
Setd7 G T 3: 51,542,665 N113K probably damaging Het
Shank2 C T 7: 144,411,424 T1502M probably damaging Het
Skor1 A T 9: 63,145,476 C376S probably damaging Het
Slc12a3 A T 8: 94,329,384 L49F probably benign Het
Slc35d3 C T 10: 19,849,331 V260M probably damaging Het
Slc46a1 T A 11: 78,466,889 V256E probably benign Het
Slc6a1 T C 6: 114,308,106 S127P probably benign Het
Syngr4 A G 7: 45,887,028 L190P probably damaging Het
Tagap G A 17: 7,926,941 probably null Het
Tamm41 A T 6: 115,035,002 N89K probably benign Het
Tbc1d31 T A 15: 57,967,912 M922K probably benign Het
Tbk1 T C 10: 121,568,080 N254S possibly damaging Het
Tfec A G 6: 16,840,479 S140P probably damaging Het
Tnrc18 T C 5: 142,740,128 E1802G unknown Het
Tom1l2 C T 11: 60,242,707 probably null Het
Tonsl T G 15: 76,637,224 K323Q probably damaging Het
Tsnaxip1 A T 8: 105,841,407 E268D probably damaging Het
Ttf1 C A 2: 29,065,160 H179N possibly damaging Het
Ttn T C 2: 76,726,173 S30163G probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Ugt1a10 G A 1: 88,218,390 R519Q probably damaging Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vwa8 G A 14: 79,103,697 probably null Het
Zfp9 A G 6: 118,464,976 Y242H probably damaging Het
Other mutations in Lmbrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Lmbrd1 APN 1 24705974 splice site probably benign
IGL01897:Lmbrd1 APN 1 24743896 missense possibly damaging 0.47
IGL01950:Lmbrd1 APN 1 24711602 critical splice donor site probably null
IGL02342:Lmbrd1 APN 1 24704878 missense probably damaging 1.00
IGL02888:Lmbrd1 APN 1 24714972 missense possibly damaging 0.94
P0033:Lmbrd1 UTSW 1 24685565 missense possibly damaging 0.95
R0479:Lmbrd1 UTSW 1 24746797 splice site probably benign
R0549:Lmbrd1 UTSW 1 24744920 missense probably benign 0.17
R1015:Lmbrd1 UTSW 1 24731878 nonsense probably null
R1423:Lmbrd1 UTSW 1 24746878 missense probably damaging 0.99
R1636:Lmbrd1 UTSW 1 24746930 nonsense probably null
R1650:Lmbrd1 UTSW 1 24711558 missense probably damaging 0.97
R1815:Lmbrd1 UTSW 1 24685561 missense possibly damaging 0.55
R2354:Lmbrd1 UTSW 1 24685541 missense probably damaging 1.00
R3690:Lmbrd1 UTSW 1 24762293 makesense probably null
R3713:Lmbrd1 UTSW 1 24692995 missense probably damaging 1.00
R4241:Lmbrd1 UTSW 1 24692968 nonsense probably null
R4782:Lmbrd1 UTSW 1 24744975 splice site probably null
R4799:Lmbrd1 UTSW 1 24744975 splice site probably null
R5341:Lmbrd1 UTSW 1 24746811 nonsense probably null
R5430:Lmbrd1 UTSW 1 24692980 missense possibly damaging 0.95
R5483:Lmbrd1 UTSW 1 24744908 missense probably damaging 1.00
R5633:Lmbrd1 UTSW 1 24748862 missense possibly damaging 0.90
R6188:Lmbrd1 UTSW 1 24711545 missense probably benign
R6383:Lmbrd1 UTSW 1 24706034 missense probably damaging 0.99
R6617:Lmbrd1 UTSW 1 24685428 missense probably damaging 1.00
R7060:Lmbrd1 UTSW 1 24692966 missense probably benign 0.00
R7365:Lmbrd1 UTSW 1 24744867 missense possibly damaging 0.62
R7621:Lmbrd1 UTSW 1 24728544 critical splice acceptor site probably null
R8807:Lmbrd1 UTSW 1 24731762 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CATTCCAGATACTTGCAAAGGC -3'
(R):5'- AAAAGCCACTTGTTTGTTCCCC -3'

Sequencing Primer
(F):5'- GGCACCTAAGATGCAGAACACTG -3'
(R):5'- CCCCACTTTTGTTTATTTTCCTTG -3'
Posted On2015-10-08