Mutagenetix > Incidental Mutations

Incidental Mutation 'R4627:Mcm6'

348822

Institutional Source

Beutler Lab

Gene Symbol

Mcm6

Ensembl Gene

ENSMUSG00000026355

Gene Name

minichromosome maintenance complex component 6

Synonyms

D1Wsu22e, Mcmd6

MMRRC Submission

041892-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4627 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128331590-128359664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128351548 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 167 (D167G)

Ref Sequence

ENSEMBL: ENSMUSP00000140308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027601] [ENSMUST00000190495]

AlphaFold

P97311

Predicted Effect

probably benign
Transcript: ENSMUST00000027601
AA Change: D167G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000027601
Gene: ENSMUSG00000026355
AA Change: D167G

Domain	Start	End	E-Value	Type
MCM	119	657	1.43e-270	SMART
PDB:2LE8\|A	710	821	1e-47	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000190495
AA Change: D167G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000140308
Gene: ENSMUSG00000026355
AA Change: D167G

Domain	Start	End	E-Value	Type
MCM	119	657	1.43e-270	SMART
PDB:2LE8\|A	710	783	3e-29	PDB

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of the complex by CDC2 kinase reduces the helicase activity, suggesting a role in the regulation of DNA replication. Single nucleotide polymorphisms in the intron regions of this gene are associated with differential transcriptional activation of the promoter of the neighboring lactase gene and, thereby, influence lactose intolerance in early adulthood. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,068,092	S393P	probably benign	Het
Adam6a	A	T	12: 113,544,949	D314V	probably benign	Het
Adamts18	C	T	8: 113,773,168	W371*	probably null	Het
Adamtsl2	T	A	2: 27,093,585	L331Q	probably damaging	Het
Akr1c13	G	T	13: 4,197,870	V214F	probably damaging	Het
Aldoart1	T	C	4: 72,852,443	T43A	probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ano7	T	C	1: 93,375,185	I15T	probably benign	Het
Aox3	A	T	1: 58,125,035	T155S	probably damaging	Het
Ap2a1	C	T	7: 44,904,419	V535M	probably damaging	Het
Apbb2	C	T	5: 66,400,076		probably null	Het
Astn1	C	A	1: 158,502,251	H225Q	possibly damaging	Het
Atm	A	G	9: 53,456,506	I2439T	possibly damaging	Het
Atp1b2	T	A	11: 69,601,334	I263F	probably damaging	Het
Ccdc184	A	T	15: 98,168,757	N148Y	probably benign	Het
Cdca7	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	2: 72,481,861		probably benign	Het
Cep192	C	G	18: 67,812,369	P180R	probably benign	Het
Cfap46	T	C	7: 139,657,281	Y571C	probably damaging	Het
Cfap46	A	T	7: 139,680,927	L85Q	probably damaging	Het
Chchd6	G	A	6: 89,384,660	L226F	probably damaging	Het
Cnot6l	A	G	5: 96,077,211	V541A	probably benign	Het
Cobl	T	C	11: 12,251,093	E1214G	probably damaging	Het
Cpsf2	G	A	12: 101,989,895	R319Q	probably benign	Het
Csdc2	T	C	15: 81,949,123	V107A	probably benign	Het
Csmd1	A	G	8: 16,697,917	W273R	probably benign	Het
Diexf	T	C	1: 193,107,695	T719A	probably benign	Het
Dnah2	T	A	11: 69,465,376	N2156I	probably damaging	Het
Dsp	A	G	13: 38,168,641	Y165C	probably benign	Het
Exoc1	T	C	5: 76,542,228	V205A	probably benign	Het
Fam98c	T	C	7: 29,155,268	T49A	possibly damaging	Het
Fbln2	G	T	6: 91,259,767	V755L	probably damaging	Het
Fhad1	A	T	4: 141,896,468	V1371D	possibly damaging	Het
Folh1	A	T	7: 86,773,252	M59K	probably benign	Het
Foxf2	A	T	13: 31,626,888	H270L	probably benign	Het
Gm14401	G	A	2: 177,086,316	R65H	probably benign	Het
Gpn1	C	A	5: 31,498,393	Y592*	probably null	Het
Hmcn1	T	G	1: 150,595,894	D4903A	probably benign	Het
Hnf1a	T	C	5: 114,955,871	R220G	probably damaging	Het
Hoxd10	G	A	2: 74,692,292	A105T	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kidins220	C	T	12: 25,057,042	T1498I	possibly damaging	Het
Klhl2	G	T	8: 64,758,191	Y274*	probably null	Het
Lmbrd1	A	G	1: 24,705,999	Y140C	probably damaging	Het
Mapk8ip3	G	A	17: 24,903,293	T706I	probably benign	Het
Mast4	A	C	13: 103,334,021	S58A	possibly damaging	Het
Mmachc	A	T	4: 116,703,471	S276T	probably damaging	Het
Nfat5	A	T	8: 107,369,276	Q1289L	probably damaging	Het
Nlrc4	G	T	17: 74,446,628	F253L	probably damaging	Het
Nr1i3	C	A	1: 171,216,445	A112E	probably benign	Het
Olfr1367	T	C	13: 21,347,464	F179L	probably damaging	Het
Olfr45	T	A	7: 140,691,378	S158T	probably benign	Het
Olfr455	T	A	6: 42,538,441	T194S	possibly damaging	Het
Olfr853	G	T	9: 19,537,673	Q86K	possibly damaging	Het
Orc5	G	T	5: 22,548,005	F10L	probably benign	Het
Pde10a	A	C	17: 8,981,652	D779A	probably damaging	Het
Pde4b	T	C	4: 102,601,605	L486S	probably damaging	Het
Pex2	A	T	3: 5,561,281	I156N	probably damaging	Het
Phtf2	C	T	5: 20,773,740	R63Q	probably damaging	Het
Prag1	A	G	8: 36,103,292	Y343C	probably damaging	Het
Prdm16	A	T	4: 154,367,240	Y170N	probably damaging	Het
Prpf6	A	C	2: 181,601,474	K5T	probably damaging	Het
Ptpn1	A	G	2: 167,967,781	K103R	probably benign	Het
Ralgapa2	A	G	2: 146,361,453	S1159P	possibly damaging	Het
Rapgef3	G	T	15: 97,758,929	D318E	probably damaging	Het
Ripk4	A	T	16: 97,744,026	S474T	probably damaging	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Sec16a	A	G	2: 26,429,393	V1491A	probably damaging	Het
Sec16a	C	T	2: 26,431,068		probably null	Het
Setd7	G	T	3: 51,542,665	N113K	probably damaging	Het
Shank2	C	T	7: 144,411,424	T1502M	probably damaging	Het
Skor1	A	T	9: 63,145,476	C376S	probably damaging	Het
Slc12a3	A	T	8: 94,329,384	L49F	probably benign	Het
Slc35d3	C	T	10: 19,849,331	V260M	probably damaging	Het
Slc46a1	T	A	11: 78,466,889	V256E	probably benign	Het
Slc6a1	T	C	6: 114,308,106	S127P	probably benign	Het
Syngr4	A	G	7: 45,887,028	L190P	probably damaging	Het
Tagap	G	A	17: 7,926,941		probably null	Het
Tamm41	A	T	6: 115,035,002	N89K	probably benign	Het
Tbc1d31	T	A	15: 57,967,912	M922K	probably benign	Het
Tbk1	T	C	10: 121,568,080	N254S	possibly damaging	Het
Tfec	A	G	6: 16,840,479	S140P	probably damaging	Het
Tnrc18	T	C	5: 142,740,128	E1802G	unknown	Het
Tom1l2	C	T	11: 60,242,707		probably null	Het
Tonsl	T	G	15: 76,637,224	K323Q	probably damaging	Het
Tsnaxip1	A	T	8: 105,841,407	E268D	probably damaging	Het
Ttf1	C	A	2: 29,065,160	H179N	possibly damaging	Het
Ttn	T	C	2: 76,726,173	S30163G	probably damaging	Het
Ube2c	A	G	2: 164,772,173	N143S	possibly damaging	Het
Ugt1a10	G	A	1: 88,218,390	R519Q	probably damaging	Het
Vmn2r9	T	C	5: 108,847,597	Y395C	probably damaging	Het
Vwa8	G	A	14: 79,103,697		probably null	Het
Zfp9	A	G	6: 118,464,976	Y242H	probably damaging	Het

Other mutations in Mcm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Mcm6	APN	1	128344383	missense	probably damaging	1.00
IGL01420:Mcm6	APN	1	128345875	missense	probably damaging	1.00
IGL01746:Mcm6	APN	1	128353524	nonsense	probably null
IGL02256:Mcm6	APN	1	128335728	critical splice donor site	probably null
IGL02624:Mcm6	APN	1	128349448	missense	possibly damaging	0.91
IGL02732:Mcm6	APN	1	128359490	missense	probably benign	0.16
IGL02750:Mcm6	APN	1	128343472	missense	probably damaging	1.00
IGL02926:Mcm6	APN	1	128339382	missense	probably damaging	1.00
IGL03189:Mcm6	APN	1	128344302	missense	probably damaging	1.00
IGL03238:Mcm6	APN	1	128355520	missense	probably benign	0.13
IGL03397:Mcm6	APN	1	128344302	missense	probably damaging	1.00
R0453:Mcm6	UTSW	1	128333555	missense	probably benign	0.00
R0501:Mcm6	UTSW	1	128355636	missense	probably benign	0.03
R0885:Mcm6	UTSW	1	128348933	missense	probably benign	0.00
R1013:Mcm6	UTSW	1	128349041	missense	probably benign
R1319:Mcm6	UTSW	1	128349052	missense	probably benign
R1396:Mcm6	UTSW	1	128351476	missense	probably damaging	1.00
R1656:Mcm6	UTSW	1	128349418	missense	possibly damaging	0.90
R1891:Mcm6	UTSW	1	128335810	missense	probably damaging	1.00
R1950:Mcm6	UTSW	1	128345989	missense	probably benign	0.35
R3411:Mcm6	UTSW	1	128351585	missense	probably benign	0.35
R4564:Mcm6	UTSW	1	128343459	missense	probably damaging	1.00
R4626:Mcm6	UTSW	1	128351548	missense	probably benign	0.01
R4628:Mcm6	UTSW	1	128351548	missense	probably benign	0.01
R4916:Mcm6	UTSW	1	128348977	missense	probably damaging	1.00
R4965:Mcm6	UTSW	1	128359486	missense	probably damaging	1.00
R4967:Mcm6	UTSW	1	128335849	missense	probably damaging	1.00
R5016:Mcm6	UTSW	1	128343427	missense	probably damaging	1.00
R5204:Mcm6	UTSW	1	128333638	missense	probably benign	0.01
R5229:Mcm6	UTSW	1	128333584	missense	possibly damaging	0.82
R5607:Mcm6	UTSW	1	128355589	missense	probably damaging	1.00
R5811:Mcm6	UTSW	1	128335728	critical splice donor site	probably benign
R5816:Mcm6	UTSW	1	128348455	missense	probably benign	0.01
R7204:Mcm6	UTSW	1	128338127	missense	probably damaging	1.00
R7316:Mcm6	UTSW	1	128359508	missense	probably damaging	1.00
R8081:Mcm6	UTSW	1	128338168	missense	probably damaging	1.00
R8546:Mcm6	UTSW	1	128345948	missense	possibly damaging	0.91
R8547:Mcm6	UTSW	1	128345948	missense	possibly damaging	0.91
R8549:Mcm6	UTSW	1	128345948	missense	possibly damaging	0.91
R8785:Mcm6	UTSW	1	128334798	missense	probably benign	0.15
R8878:Mcm6	UTSW	1	128355511	critical splice donor site	probably null
R9043:Mcm6	UTSW	1	128343494	missense	probably damaging	1.00
R9253:Mcm6	UTSW	1	128351527	missense	probably damaging	1.00
Z1088:Mcm6	UTSW	1	128344298	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATACCTTCTGGCCTCTGTG -3'
(R):5'- ATCCCTGGAACTGAAGTGGG -3'

Sequencing Primer
(F):5'- GTGGGCACTACATTCCTTAAAAACTG -3'
(R):5'- CCCTGGAACTGAAGTGGGGAAAG -3'

Posted On

2015-10-08