Incidental Mutation 'R4627:Mcm6'
ID348822
Institutional Source Beutler Lab
Gene Symbol Mcm6
Ensembl Gene ENSMUSG00000026355
Gene Nameminichromosome maintenance complex component 6
SynonymsD1Wsu22e, Mcmd6
MMRRC Submission 041892-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4627 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location128331590-128359664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128351548 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 167 (D167G)
Ref Sequence ENSEMBL: ENSMUSP00000140308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027601] [ENSMUST00000190495]
Predicted Effect probably benign
Transcript: ENSMUST00000027601
AA Change: D167G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027601
Gene: ENSMUSG00000026355
AA Change: D167G

DomainStartEndE-ValueType
MCM 119 657 1.43e-270 SMART
PDB:2LE8|A 710 821 1e-47 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190495
AA Change: D167G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000140308
Gene: ENSMUSG00000026355
AA Change: D167G

DomainStartEndE-ValueType
MCM 119 657 1.43e-270 SMART
PDB:2LE8|A 710 783 3e-29 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of the complex by CDC2 kinase reduces the helicase activity, suggesting a role in the regulation of DNA replication. Single nucleotide polymorphisms in the intron regions of this gene are associated with differential transcriptional activation of the promoter of the neighboring lactase gene and, thereby, influence lactose intolerance in early adulthood. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Adam6a A T 12: 113,544,949 D314V probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Adamtsl2 T A 2: 27,093,585 L331Q probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Aldoart1 T C 4: 72,852,443 T43A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ano7 T C 1: 93,375,185 I15T probably benign Het
Aox3 A T 1: 58,125,035 T155S probably damaging Het
Ap2a1 C T 7: 44,904,419 V535M probably damaging Het
Apbb2 C T 5: 66,400,076 probably null Het
Astn1 C A 1: 158,502,251 H225Q possibly damaging Het
Atm A G 9: 53,456,506 I2439T possibly damaging Het
Atp1b2 T A 11: 69,601,334 I263F probably damaging Het
Ccdc184 A T 15: 98,168,757 N148Y probably benign Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Cep192 C G 18: 67,812,369 P180R probably benign Het
Cfap46 T C 7: 139,657,281 Y571C probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chchd6 G A 6: 89,384,660 L226F probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cobl T C 11: 12,251,093 E1214G probably damaging Het
Cpsf2 G A 12: 101,989,895 R319Q probably benign Het
Csdc2 T C 15: 81,949,123 V107A probably benign Het
Csmd1 A G 8: 16,697,917 W273R probably benign Het
Diexf T C 1: 193,107,695 T719A probably benign Het
Dnah2 T A 11: 69,465,376 N2156I probably damaging Het
Dsp A G 13: 38,168,641 Y165C probably benign Het
Exoc1 T C 5: 76,542,228 V205A probably benign Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fbln2 G T 6: 91,259,767 V755L probably damaging Het
Fhad1 A T 4: 141,896,468 V1371D possibly damaging Het
Folh1 A T 7: 86,773,252 M59K probably benign Het
Foxf2 A T 13: 31,626,888 H270L probably benign Het
Gm14401 G A 2: 177,086,316 R65H probably benign Het
Gpn1 C A 5: 31,498,393 Y592* probably null Het
Hmcn1 T G 1: 150,595,894 D4903A probably benign Het
Hnf1a T C 5: 114,955,871 R220G probably damaging Het
Hoxd10 G A 2: 74,692,292 A105T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 C T 12: 25,057,042 T1498I possibly damaging Het
Klhl2 G T 8: 64,758,191 Y274* probably null Het
Lmbrd1 A G 1: 24,705,999 Y140C probably damaging Het
Mapk8ip3 G A 17: 24,903,293 T706I probably benign Het
Mast4 A C 13: 103,334,021 S58A possibly damaging Het
Mmachc A T 4: 116,703,471 S276T probably damaging Het
Nfat5 A T 8: 107,369,276 Q1289L probably damaging Het
Nlrc4 G T 17: 74,446,628 F253L probably damaging Het
Nr1i3 C A 1: 171,216,445 A112E probably benign Het
Olfr1367 T C 13: 21,347,464 F179L probably damaging Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr455 T A 6: 42,538,441 T194S possibly damaging Het
Olfr853 G T 9: 19,537,673 Q86K possibly damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pde10a A C 17: 8,981,652 D779A probably damaging Het
Pde4b T C 4: 102,601,605 L486S probably damaging Het
Pex2 A T 3: 5,561,281 I156N probably damaging Het
Phtf2 C T 5: 20,773,740 R63Q probably damaging Het
Prag1 A G 8: 36,103,292 Y343C probably damaging Het
Prdm16 A T 4: 154,367,240 Y170N probably damaging Het
Prpf6 A C 2: 181,601,474 K5T probably damaging Het
Ptpn1 A G 2: 167,967,781 K103R probably benign Het
Ralgapa2 A G 2: 146,361,453 S1159P possibly damaging Het
Rapgef3 G T 15: 97,758,929 D318E probably damaging Het
Ripk4 A T 16: 97,744,026 S474T probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Sec16a A G 2: 26,429,393 V1491A probably damaging Het
Sec16a C T 2: 26,431,068 probably null Het
Setd7 G T 3: 51,542,665 N113K probably damaging Het
Shank2 C T 7: 144,411,424 T1502M probably damaging Het
Skor1 A T 9: 63,145,476 C376S probably damaging Het
Slc12a3 A T 8: 94,329,384 L49F probably benign Het
Slc35d3 C T 10: 19,849,331 V260M probably damaging Het
Slc46a1 T A 11: 78,466,889 V256E probably benign Het
Slc6a1 T C 6: 114,308,106 S127P probably benign Het
Syngr4 A G 7: 45,887,028 L190P probably damaging Het
Tagap G A 17: 7,926,941 probably null Het
Tamm41 A T 6: 115,035,002 N89K probably benign Het
Tbc1d31 T A 15: 57,967,912 M922K probably benign Het
Tbk1 T C 10: 121,568,080 N254S possibly damaging Het
Tfec A G 6: 16,840,479 S140P probably damaging Het
Tnrc18 T C 5: 142,740,128 E1802G unknown Het
Tom1l2 C T 11: 60,242,707 probably null Het
Tonsl T G 15: 76,637,224 K323Q probably damaging Het
Tsnaxip1 A T 8: 105,841,407 E268D probably damaging Het
Ttf1 C A 2: 29,065,160 H179N possibly damaging Het
Ttn T C 2: 76,726,173 S30163G probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Ugt1a10 G A 1: 88,218,390 R519Q probably damaging Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vwa8 G A 14: 79,103,697 probably null Het
Zfp9 A G 6: 118,464,976 Y242H probably damaging Het
Other mutations in Mcm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Mcm6 APN 1 128344383 missense probably damaging 1.00
IGL01420:Mcm6 APN 1 128345875 missense probably damaging 1.00
IGL01746:Mcm6 APN 1 128353524 nonsense probably null
IGL02256:Mcm6 APN 1 128335728 critical splice donor site probably null
IGL02624:Mcm6 APN 1 128349448 missense possibly damaging 0.91
IGL02732:Mcm6 APN 1 128359490 missense probably benign 0.16
IGL02750:Mcm6 APN 1 128343472 missense probably damaging 1.00
IGL02926:Mcm6 APN 1 128339382 missense probably damaging 1.00
IGL03189:Mcm6 APN 1 128344302 missense probably damaging 1.00
IGL03238:Mcm6 APN 1 128355520 missense probably benign 0.13
IGL03397:Mcm6 APN 1 128344302 missense probably damaging 1.00
R0453:Mcm6 UTSW 1 128333555 missense probably benign 0.00
R0501:Mcm6 UTSW 1 128355636 missense probably benign 0.03
R0885:Mcm6 UTSW 1 128348933 missense probably benign 0.00
R1013:Mcm6 UTSW 1 128349041 missense probably benign
R1319:Mcm6 UTSW 1 128349052 missense probably benign
R1396:Mcm6 UTSW 1 128351476 missense probably damaging 1.00
R1656:Mcm6 UTSW 1 128349418 missense possibly damaging 0.90
R1891:Mcm6 UTSW 1 128335810 missense probably damaging 1.00
R1950:Mcm6 UTSW 1 128345989 missense probably benign 0.35
R3411:Mcm6 UTSW 1 128351585 missense probably benign 0.35
R4564:Mcm6 UTSW 1 128343459 missense probably damaging 1.00
R4626:Mcm6 UTSW 1 128351548 missense probably benign 0.01
R4628:Mcm6 UTSW 1 128351548 missense probably benign 0.01
R4916:Mcm6 UTSW 1 128348977 missense probably damaging 1.00
R4965:Mcm6 UTSW 1 128359486 missense probably damaging 1.00
R4967:Mcm6 UTSW 1 128335849 missense probably damaging 1.00
R5016:Mcm6 UTSW 1 128343427 missense probably damaging 1.00
R5204:Mcm6 UTSW 1 128333638 missense probably benign 0.01
R5229:Mcm6 UTSW 1 128333584 missense possibly damaging 0.82
R5607:Mcm6 UTSW 1 128355589 missense probably damaging 1.00
R5811:Mcm6 UTSW 1 128335728 critical splice donor site probably benign
R5816:Mcm6 UTSW 1 128348455 missense probably benign 0.01
R7204:Mcm6 UTSW 1 128338127 missense probably damaging 1.00
R7316:Mcm6 UTSW 1 128359508 missense probably damaging 1.00
R8081:Mcm6 UTSW 1 128338168 missense probably damaging 1.00
R8546:Mcm6 UTSW 1 128345948 missense possibly damaging 0.91
R8547:Mcm6 UTSW 1 128345948 missense possibly damaging 0.91
R8549:Mcm6 UTSW 1 128345948 missense possibly damaging 0.91
R8785:Mcm6 UTSW 1 128334798 missense probably benign 0.15
Z1088:Mcm6 UTSW 1 128344298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATACCTTCTGGCCTCTGTG -3'
(R):5'- ATCCCTGGAACTGAAGTGGG -3'

Sequencing Primer
(F):5'- GTGGGCACTACATTCCTTAAAAACTG -3'
(R):5'- CCCTGGAACTGAAGTGGGGAAAG -3'
Posted On2015-10-08