Incidental Mutation 'R4627:Utp25'
ID 348827
Institutional Source Beutler Lab
Gene Symbol Utp25
Ensembl Gene ENSMUSG00000016181
Gene Name UTP25 small subunit processome component
Synonyms AA408296, mDef, Diexf
MMRRC Submission 041892-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.969) question?
Stock # R4627 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 192786707-192812603 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 192790003 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 719 (T719A)
Ref Sequence ENSEMBL: ENSMUSP00000082691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085555] [ENSMUST00000193460] [ENSMUST00000195291]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000085555
AA Change: T719A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000082691
Gene: ENSMUSG00000016181
AA Change: T719A

DomainStartEndE-ValueType
low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:UTP25 288 763 6.1e-200 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193070
Predicted Effect probably benign
Transcript: ENSMUST00000193460
SMART Domains Protein: ENSMUSP00000142059
Gene: ENSMUSG00000016181

DomainStartEndE-ValueType
Pfam:DUF1253 1 205 6.8e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194412
Predicted Effect probably benign
Transcript: ENSMUST00000195291
SMART Domains Protein: ENSMUSP00000141676
Gene: ENSMUSG00000016181

DomainStartEndE-ValueType
low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:DUF1253 325 634 6.9e-100 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,508,569 (GRCm39) D314V probably benign Het
Adamts18 C T 8: 114,499,800 (GRCm39) W371* probably null Het
Adamtsl2 T A 2: 26,983,597 (GRCm39) L331Q probably damaging Het
Akr1c13 G T 13: 4,247,869 (GRCm39) V214F probably damaging Het
Aldoart1 T C 4: 72,770,680 (GRCm39) T43A probably benign Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Ano7 T C 1: 93,302,907 (GRCm39) I15T probably benign Het
Aopep T C 13: 63,215,906 (GRCm39) S393P probably benign Het
Aox3 A T 1: 58,164,194 (GRCm39) T155S probably damaging Het
Ap2a1 C T 7: 44,553,843 (GRCm39) V535M probably damaging Het
Apbb2 C T 5: 66,557,419 (GRCm39) probably null Het
Astn1 C A 1: 158,329,821 (GRCm39) H225Q possibly damaging Het
Atm A G 9: 53,367,806 (GRCm39) I2439T possibly damaging Het
Atp1b2 T A 11: 69,492,160 (GRCm39) I263F probably damaging Het
Ccdc184 A T 15: 98,066,638 (GRCm39) N148Y probably benign Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,312,205 (GRCm39) probably benign Het
Cep192 C G 18: 67,945,440 (GRCm39) P180R probably benign Het
Cfap46 T C 7: 139,237,197 (GRCm39) Y571C probably damaging Het
Cfap46 A T 7: 139,260,843 (GRCm39) L85Q probably damaging Het
Chchd6 G A 6: 89,361,642 (GRCm39) L226F probably damaging Het
Cnot6l A G 5: 96,225,070 (GRCm39) V541A probably benign Het
Cobl T C 11: 12,201,093 (GRCm39) E1214G probably damaging Het
Cpsf2 G A 12: 101,956,154 (GRCm39) R319Q probably benign Het
Csdc2 T C 15: 81,833,324 (GRCm39) V107A probably benign Het
Csmd1 A G 8: 16,747,933 (GRCm39) W273R probably benign Het
Dnah2 T A 11: 69,356,202 (GRCm39) N2156I probably damaging Het
Dsp A G 13: 38,352,617 (GRCm39) Y165C probably benign Het
Exoc1 T C 5: 76,690,075 (GRCm39) V205A probably benign Het
Fam98c T C 7: 28,854,693 (GRCm39) T49A possibly damaging Het
Fbln2 G T 6: 91,236,749 (GRCm39) V755L probably damaging Het
Fhad1 A T 4: 141,623,779 (GRCm39) V1371D possibly damaging Het
Folh1 A T 7: 86,422,460 (GRCm39) M59K probably benign Het
Foxf2 A T 13: 31,810,871 (GRCm39) H270L probably benign Het
Gm14401 G A 2: 176,778,109 (GRCm39) R65H probably benign Het
Gpn1 C A 5: 31,655,737 (GRCm39) Y592* probably null Het
Hmcn1 T G 1: 150,471,645 (GRCm39) D4903A probably benign Het
Hnf1a T C 5: 115,093,930 (GRCm39) R220G probably damaging Het
Hoxd10 G A 2: 74,522,636 (GRCm39) A105T probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kidins220 C T 12: 25,107,041 (GRCm39) T1498I possibly damaging Het
Klhl2 G T 8: 65,211,225 (GRCm39) Y274* probably null Het
Lmbrd1 A G 1: 24,745,080 (GRCm39) Y140C probably damaging Het
Mapk8ip3 G A 17: 25,122,267 (GRCm39) T706I probably benign Het
Mast4 A C 13: 103,470,529 (GRCm39) S58A possibly damaging Het
Mcm6 T C 1: 128,279,285 (GRCm39) D167G probably benign Het
Mmachc A T 4: 116,560,668 (GRCm39) S276T probably damaging Het
Nfat5 A T 8: 108,095,908 (GRCm39) Q1289L probably damaging Het
Nlrc4 G T 17: 74,753,623 (GRCm39) F253L probably damaging Het
Nr1i3 C A 1: 171,044,014 (GRCm39) A112E probably benign Het
Or10ac1 T A 6: 42,515,375 (GRCm39) T194S possibly damaging Het
Or13a17 T A 7: 140,271,291 (GRCm39) S158T probably benign Het
Or2b28 T C 13: 21,531,634 (GRCm39) F179L probably damaging Het
Or7g33 G T 9: 19,448,969 (GRCm39) Q86K possibly damaging Het
Orc5 G T 5: 22,753,003 (GRCm39) F10L probably benign Het
Pde10a A C 17: 9,200,484 (GRCm39) D779A probably damaging Het
Pde4b T C 4: 102,458,802 (GRCm39) L486S probably damaging Het
Pex2 A T 3: 5,626,341 (GRCm39) I156N probably damaging Het
Phtf2 C T 5: 20,978,738 (GRCm39) R63Q probably damaging Het
Prag1 A G 8: 36,570,446 (GRCm39) Y343C probably damaging Het
Prdm16 A T 4: 154,451,697 (GRCm39) Y170N probably damaging Het
Prpf6 A C 2: 181,243,267 (GRCm39) K5T probably damaging Het
Ptpn1 A G 2: 167,809,701 (GRCm39) K103R probably benign Het
Ralgapa2 A G 2: 146,203,373 (GRCm39) S1159P possibly damaging Het
Rapgef3 G T 15: 97,656,810 (GRCm39) D318E probably damaging Het
Ripk4 A T 16: 97,545,226 (GRCm39) S474T probably damaging Het
Rmi1 A G 13: 58,556,950 (GRCm39) R400G probably benign Het
Sec16a A G 2: 26,319,405 (GRCm39) V1491A probably damaging Het
Sec16a C T 2: 26,321,080 (GRCm39) probably null Het
Setd7 G T 3: 51,450,086 (GRCm39) N113K probably damaging Het
Shank2 C T 7: 143,965,161 (GRCm39) T1502M probably damaging Het
Skor1 A T 9: 63,052,758 (GRCm39) C376S probably damaging Het
Slc12a3 A T 8: 95,056,012 (GRCm39) L49F probably benign Het
Slc35d3 C T 10: 19,725,077 (GRCm39) V260M probably damaging Het
Slc46a1 T A 11: 78,357,715 (GRCm39) V256E probably benign Het
Slc6a1 T C 6: 114,285,067 (GRCm39) S127P probably benign Het
Syngr4 A G 7: 45,536,452 (GRCm39) L190P probably damaging Het
Tagap G A 17: 8,145,773 (GRCm39) probably null Het
Tamm41 A T 6: 115,011,963 (GRCm39) N89K probably benign Het
Tbc1d31 T A 15: 57,831,308 (GRCm39) M922K probably benign Het
Tbk1 T C 10: 121,403,985 (GRCm39) N254S possibly damaging Het
Tfec A G 6: 16,840,478 (GRCm39) S140P probably damaging Het
Tnrc18 T C 5: 142,725,883 (GRCm39) E1802G unknown Het
Tom1l2 C T 11: 60,133,533 (GRCm39) probably null Het
Tonsl T G 15: 76,521,424 (GRCm39) K323Q probably damaging Het
Tsnaxip1 A T 8: 106,568,039 (GRCm39) E268D probably damaging Het
Ttf1 C A 2: 28,955,172 (GRCm39) H179N possibly damaging Het
Ttn T C 2: 76,556,517 (GRCm39) S30163G probably damaging Het
Ube2c A G 2: 164,614,093 (GRCm39) N143S possibly damaging Het
Ugt1a10 G A 1: 88,146,112 (GRCm39) R519Q probably damaging Het
Vmn2r9 T C 5: 108,995,463 (GRCm39) Y395C probably damaging Het
Vwa8 G A 14: 79,341,137 (GRCm39) probably null Het
Zfp9 A G 6: 118,441,937 (GRCm39) Y242H probably damaging Het
Other mutations in Utp25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Utp25 APN 1 192,797,309 (GRCm39) missense probably damaging 1.00
IGL01700:Utp25 APN 1 192,800,573 (GRCm39) missense probably damaging 1.00
IGL02076:Utp25 APN 1 192,812,367 (GRCm39) missense probably damaging 1.00
IGL02121:Utp25 APN 1 192,800,586 (GRCm39) missense probably benign 0.05
IGL02666:Utp25 APN 1 192,789,904 (GRCm39) nonsense probably null
IGL02997:Utp25 APN 1 192,802,892 (GRCm39) missense probably benign 0.34
3-1:Utp25 UTSW 1 192,800,588 (GRCm39) missense probably benign 0.07
R0099:Utp25 UTSW 1 192,810,778 (GRCm39) missense probably damaging 1.00
R0395:Utp25 UTSW 1 192,805,984 (GRCm39) missense possibly damaging 0.69
R0502:Utp25 UTSW 1 192,797,136 (GRCm39) splice site probably benign
R0973:Utp25 UTSW 1 192,797,011 (GRCm39) missense probably damaging 0.98
R0973:Utp25 UTSW 1 192,797,011 (GRCm39) missense probably damaging 0.98
R0974:Utp25 UTSW 1 192,797,011 (GRCm39) missense probably damaging 0.98
R1815:Utp25 UTSW 1 192,800,591 (GRCm39) missense probably benign 0.26
R1930:Utp25 UTSW 1 192,800,617 (GRCm39) missense probably damaging 1.00
R1931:Utp25 UTSW 1 192,800,617 (GRCm39) missense probably damaging 1.00
R1937:Utp25 UTSW 1 192,804,401 (GRCm39) missense probably damaging 1.00
R2847:Utp25 UTSW 1 192,810,759 (GRCm39) missense probably benign 0.41
R2848:Utp25 UTSW 1 192,810,759 (GRCm39) missense probably benign 0.41
R3412:Utp25 UTSW 1 192,810,810 (GRCm39) missense possibly damaging 0.93
R3414:Utp25 UTSW 1 192,810,810 (GRCm39) missense possibly damaging 0.93
R4471:Utp25 UTSW 1 192,812,445 (GRCm39) missense possibly damaging 0.68
R4644:Utp25 UTSW 1 192,810,788 (GRCm39) missense probably damaging 1.00
R4761:Utp25 UTSW 1 192,796,230 (GRCm39) missense probably damaging 1.00
R4791:Utp25 UTSW 1 192,810,575 (GRCm39) missense probably benign
R4793:Utp25 UTSW 1 192,796,116 (GRCm39) missense probably null 0.56
R4858:Utp25 UTSW 1 192,796,072 (GRCm39) missense probably damaging 1.00
R4944:Utp25 UTSW 1 192,797,262 (GRCm39) missense probably damaging 1.00
R5162:Utp25 UTSW 1 192,796,089 (GRCm39) missense probably damaging 1.00
R5347:Utp25 UTSW 1 192,810,687 (GRCm39) missense probably benign
R5837:Utp25 UTSW 1 192,800,701 (GRCm39) missense probably damaging 1.00
R6113:Utp25 UTSW 1 192,811,810 (GRCm39) missense probably null 0.01
R6455:Utp25 UTSW 1 192,810,684 (GRCm39) missense probably benign 0.07
R6563:Utp25 UTSW 1 192,800,698 (GRCm39) missense probably damaging 1.00
R6636:Utp25 UTSW 1 192,796,075 (GRCm39) missense probably damaging 1.00
R7018:Utp25 UTSW 1 192,797,163 (GRCm39) missense probably benign 0.06
R7037:Utp25 UTSW 1 192,803,031 (GRCm39) splice site probably null
R8027:Utp25 UTSW 1 192,800,530 (GRCm39) missense probably benign
R8042:Utp25 UTSW 1 192,796,980 (GRCm39) missense
R8092:Utp25 UTSW 1 192,802,671 (GRCm39) missense probably benign 0.00
R8243:Utp25 UTSW 1 192,796,937 (GRCm39) missense probably benign
R8691:Utp25 UTSW 1 192,796,110 (GRCm39) missense probably benign 0.41
R9485:Utp25 UTSW 1 192,812,541 (GRCm39) unclassified probably benign
RF021:Utp25 UTSW 1 192,802,974 (GRCm39) missense probably benign
X0050:Utp25 UTSW 1 192,806,040 (GRCm39) missense probably benign 0.23
Z1177:Utp25 UTSW 1 192,796,983 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTGAACAGATCAGGTC -3'
(R):5'- TGTAGAGCCAAGTGTCTGTGAAG -3'

Sequencing Primer
(F):5'- GAGGTCCAACAATGTAGTCCGTTC -3'
(R):5'- TCTGTGAAGCCGCTGACATG -3'
Posted On 2015-10-08