Mutagenetix > Incidental Mutation

Incidental Mutation 'R4627:Sec16a'

348828

Institutional Source

Beutler Lab

Gene Symbol

Sec16a

Ensembl Gene

ENSMUSG00000026924

Gene Name

SEC16 homolog A, endoplasmic reticulum export factor

Synonyms

C230052J16Rik

MMRRC Submission

041892-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R4627 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26409431-26445216 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 26429393 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1491 (V1491A)

Ref Sequence

ENSEMBL: ENSMUSP00000109716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]

AlphaFold

E9QAT4

Predicted Effect

probably damaging
Transcript: ENSMUST00000091252
AA Change: V1491A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: V1491A

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1463	1565	3.1e-24	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1635	1898	2.3e-39	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114082
AA Change: V1491A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: V1491A

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1464	1564	2.6e-10	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1636	1887	6.8e-45	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC
low complexity region	2310	2320	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000156442
AA Change: V40A

SMART Domains

Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924
AA Change: V40A

Domain	Start	End	E-Value	Type
Pfam:Sec16	14	114	7.7e-11	PFAM
low complexity region	150	164	N/A	INTRINSIC
Pfam:Sec16_C	186	438	1.6e-45	PFAM
low complexity region	659	674	N/A	INTRINSIC
low complexity region	715	727	N/A	INTRINSIC
low complexity region	737	747	N/A	INTRINSIC
low complexity region	777	792	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,068,092	S393P	probably benign	Het
Adam6a	A	T	12: 113,544,949	D314V	probably benign	Het
Adamts18	C	T	8: 113,773,168	W371*	probably null	Het
Adamtsl2	T	A	2: 27,093,585	L331Q	probably damaging	Het
Akr1c13	G	T	13: 4,197,870	V214F	probably damaging	Het
Aldoart1	T	C	4: 72,852,443	T43A	probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ano7	T	C	1: 93,375,185	I15T	probably benign	Het
Aox3	A	T	1: 58,125,035	T155S	probably damaging	Het
Ap2a1	C	T	7: 44,904,419	V535M	probably damaging	Het
Apbb2	C	T	5: 66,400,076		probably null	Het
Astn1	C	A	1: 158,502,251	H225Q	possibly damaging	Het
Atm	A	G	9: 53,456,506	I2439T	possibly damaging	Het
Atp1b2	T	A	11: 69,601,334	I263F	probably damaging	Het
Ccdc184	A	T	15: 98,168,757	N148Y	probably benign	Het
Cdca7	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	2: 72,481,861		probably benign	Het
Cep192	C	G	18: 67,812,369	P180R	probably benign	Het
Cfap46	T	C	7: 139,657,281	Y571C	probably damaging	Het
Cfap46	A	T	7: 139,680,927	L85Q	probably damaging	Het
Chchd6	G	A	6: 89,384,660	L226F	probably damaging	Het
Cnot6l	A	G	5: 96,077,211	V541A	probably benign	Het
Cobl	T	C	11: 12,251,093	E1214G	probably damaging	Het
Cpsf2	G	A	12: 101,989,895	R319Q	probably benign	Het
Csdc2	T	C	15: 81,949,123	V107A	probably benign	Het
Csmd1	A	G	8: 16,697,917	W273R	probably benign	Het
Diexf	T	C	1: 193,107,695	T719A	probably benign	Het
Dnah2	T	A	11: 69,465,376	N2156I	probably damaging	Het
Dsp	A	G	13: 38,168,641	Y165C	probably benign	Het
Exoc1	T	C	5: 76,542,228	V205A	probably benign	Het
Fam98c	T	C	7: 29,155,268	T49A	possibly damaging	Het
Fbln2	G	T	6: 91,259,767	V755L	probably damaging	Het
Fhad1	A	T	4: 141,896,468	V1371D	possibly damaging	Het
Folh1	A	T	7: 86,773,252	M59K	probably benign	Het
Foxf2	A	T	13: 31,626,888	H270L	probably benign	Het
Gm14401	G	A	2: 177,086,316	R65H	probably benign	Het
Gpn1	C	A	5: 31,498,393	Y592*	probably null	Het
Hmcn1	T	G	1: 150,595,894	D4903A	probably benign	Het
Hnf1a	T	C	5: 114,955,871	R220G	probably damaging	Het
Hoxd10	G	A	2: 74,692,292	A105T	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kidins220	C	T	12: 25,057,042	T1498I	possibly damaging	Het
Klhl2	G	T	8: 64,758,191	Y274*	probably null	Het
Lmbrd1	A	G	1: 24,705,999	Y140C	probably damaging	Het
Mapk8ip3	G	A	17: 24,903,293	T706I	probably benign	Het
Mast4	A	C	13: 103,334,021	S58A	possibly damaging	Het
Mcm6	T	C	1: 128,351,548	D167G	probably benign	Het
Mmachc	A	T	4: 116,703,471	S276T	probably damaging	Het
Nfat5	A	T	8: 107,369,276	Q1289L	probably damaging	Het
Nlrc4	G	T	17: 74,446,628	F253L	probably damaging	Het
Nr1i3	C	A	1: 171,216,445	A112E	probably benign	Het
Olfr1367	T	C	13: 21,347,464	F179L	probably damaging	Het
Olfr45	T	A	7: 140,691,378	S158T	probably benign	Het
Olfr455	T	A	6: 42,538,441	T194S	possibly damaging	Het
Olfr853	G	T	9: 19,537,673	Q86K	possibly damaging	Het
Orc5	G	T	5: 22,548,005	F10L	probably benign	Het
Pde10a	A	C	17: 8,981,652	D779A	probably damaging	Het
Pde4b	T	C	4: 102,601,605	L486S	probably damaging	Het
Pex2	A	T	3: 5,561,281	I156N	probably damaging	Het
Phtf2	C	T	5: 20,773,740	R63Q	probably damaging	Het
Prag1	A	G	8: 36,103,292	Y343C	probably damaging	Het
Prdm16	A	T	4: 154,367,240	Y170N	probably damaging	Het
Prpf6	A	C	2: 181,601,474	K5T	probably damaging	Het
Ptpn1	A	G	2: 167,967,781	K103R	probably benign	Het
Ralgapa2	A	G	2: 146,361,453	S1159P	possibly damaging	Het
Rapgef3	G	T	15: 97,758,929	D318E	probably damaging	Het
Ripk4	A	T	16: 97,744,026	S474T	probably damaging	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Setd7	G	T	3: 51,542,665	N113K	probably damaging	Het
Shank2	C	T	7: 144,411,424	T1502M	probably damaging	Het
Skor1	A	T	9: 63,145,476	C376S	probably damaging	Het
Slc12a3	A	T	8: 94,329,384	L49F	probably benign	Het
Slc35d3	C	T	10: 19,849,331	V260M	probably damaging	Het
Slc46a1	T	A	11: 78,466,889	V256E	probably benign	Het
Slc6a1	T	C	6: 114,308,106	S127P	probably benign	Het
Syngr4	A	G	7: 45,887,028	L190P	probably damaging	Het
Tagap	G	A	17: 7,926,941		probably null	Het
Tamm41	A	T	6: 115,035,002	N89K	probably benign	Het
Tbc1d31	T	A	15: 57,967,912	M922K	probably benign	Het
Tbk1	T	C	10: 121,568,080	N254S	possibly damaging	Het
Tfec	A	G	6: 16,840,479	S140P	probably damaging	Het
Tnrc18	T	C	5: 142,740,128	E1802G	unknown	Het
Tom1l2	C	T	11: 60,242,707		probably null	Het
Tonsl	T	G	15: 76,637,224	K323Q	probably damaging	Het
Tsnaxip1	A	T	8: 105,841,407	E268D	probably damaging	Het
Ttf1	C	A	2: 29,065,160	H179N	possibly damaging	Het
Ttn	T	C	2: 76,726,173	S30163G	probably damaging	Het
Ube2c	A	G	2: 164,772,173	N143S	possibly damaging	Het
Ugt1a10	G	A	1: 88,218,390	R519Q	probably damaging	Het
Vmn2r9	T	C	5: 108,847,597	Y395C	probably damaging	Het
Vwa8	G	A	14: 79,103,697		probably null	Het
Zfp9	A	G	6: 118,464,976	Y242H	probably damaging	Het

Other mutations in Sec16a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Sec16a	APN	2	26439487	missense	probably benign	0.15
IGL00435:Sec16a	APN	2	26430101	missense	probably benign	0.00
IGL00469:Sec16a	APN	2	26428300	missense	probably damaging	1.00
IGL01622:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL01623:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL02158:Sec16a	APN	2	26416632	critical splice donor site	probably null
IGL02188:Sec16a	APN	2	26436008	missense	probably damaging	1.00
IGL02445:Sec16a	APN	2	26422040	missense	probably benign
IGL02568:Sec16a	APN	2	26436042	missense	probably damaging	1.00
IGL02710:Sec16a	APN	2	26430130	missense	possibly damaging	0.75
IGL02735:Sec16a	APN	2	26428137	splice site	probably benign
IGL02964:Sec16a	APN	2	26419723	missense	probably benign	0.00
IGL03027:Sec16a	APN	2	26423589	missense	probably benign	0.13
IGL03073:Sec16a	APN	2	26439183	missense	probably benign	0.02
IGL03297:Sec16a	APN	2	26439190	missense	probably benign	0.05
IGL03339:Sec16a	APN	2	26435933	missense	probably benign
H8562:Sec16a	UTSW	2	26441505	missense	probably benign
IGL03050:Sec16a	UTSW	2	26415747	missense	probably damaging	1.00
PIT4486001:Sec16a	UTSW	2	26425773	missense
R0039:Sec16a	UTSW	2	26423914	missense	probably benign	0.03
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0189:Sec16a	UTSW	2	26424414	splice site	probably null
R0255:Sec16a	UTSW	2	26431186	missense	probably damaging	0.97
R0278:Sec16a	UTSW	2	26428316	missense	probably damaging	1.00
R0739:Sec16a	UTSW	2	26441051	missense	possibly damaging	0.94
R0743:Sec16a	UTSW	2	26419722	missense	possibly damaging	0.67
R1446:Sec16a	UTSW	2	26423567	missense	probably benign	0.00
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1501:Sec16a	UTSW	2	26440045	missense	probably benign	0.16
R1524:Sec16a	UTSW	2	26428382	missense	probably damaging	1.00
R1584:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1649:Sec16a	UTSW	2	26425524	missense	probably damaging	1.00
R1744:Sec16a	UTSW	2	26439186	missense	probably damaging	1.00
R1959:Sec16a	UTSW	2	26430132	missense	probably benign	0.00
R1973:Sec16a	UTSW	2	26426489	missense	probably damaging	1.00
R2005:Sec16a	UTSW	2	26439080	missense	probably benign	0.27
R2073:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2074:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2075:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2151:Sec16a	UTSW	2	26413745	intron	probably benign
R2472:Sec16a	UTSW	2	26439936	missense	probably damaging	1.00
R2512:Sec16a	UTSW	2	26439025	missense	probably benign	0.00
R2520:Sec16a	UTSW	2	26441356	nonsense	probably null
R2571:Sec16a	UTSW	2	26439331	missense	probably benign	0.08
R3105:Sec16a	UTSW	2	26438421	missense	probably benign	0.14
R3508:Sec16a	UTSW	2	26425850	missense	probably damaging	1.00
R3809:Sec16a	UTSW	2	26441813	missense	possibly damaging	0.71
R3912:Sec16a	UTSW	2	26414387	missense	probably damaging	0.97
R4292:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4293:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4294:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4576:Sec16a	UTSW	2	26431119	nonsense	probably null
R4611:Sec16a	UTSW	2	26441805	missense	probably benign	0.04
R4627:Sec16a	UTSW	2	26431068	splice site	probably null
R4662:Sec16a	UTSW	2	26430570	missense	probably damaging	1.00
R4665:Sec16a	UTSW	2	26412958	intron	probably benign
R4906:Sec16a	UTSW	2	26441967	unclassified	probably benign
R4967:Sec16a	UTSW	2	26412871	missense	probably benign	0.00
R4983:Sec16a	UTSW	2	26439519	missense	probably benign
R5033:Sec16a	UTSW	2	26419649	missense	probably benign	0.00
R5251:Sec16a	UTSW	2	26439345	missense	probably benign	0.00
R5391:Sec16a	UTSW	2	26440032	missense	possibly damaging	0.82
R5457:Sec16a	UTSW	2	26440268	missense	probably benign	0.01
R5530:Sec16a	UTSW	2	26439252	missense	probably benign	0.00
R5645:Sec16a	UTSW	2	26439895	missense	probably benign	0.01
R5661:Sec16a	UTSW	2	26439637	missense	probably benign	0.01
R5770:Sec16a	UTSW	2	26414390	missense	probably damaging	0.99
R5830:Sec16a	UTSW	2	26440841	missense	probably benign	0.15
R5866:Sec16a	UTSW	2	26419638	missense	probably benign	0.00
R5875:Sec16a	UTSW	2	26433367	missense	probably damaging	1.00
R5906:Sec16a	UTSW	2	26438831	missense	possibly damaging	0.63
R5922:Sec16a	UTSW	2	26415639	missense	probably benign	0.05
R6076:Sec16a	UTSW	2	26423942	missense	probably damaging	1.00
R6091:Sec16a	UTSW	2	26426470	missense	probably damaging	1.00
R6295:Sec16a	UTSW	2	26428241	missense	probably damaging	1.00
R6302:Sec16a	UTSW	2	26425805	missense	probably damaging	1.00
R6309:Sec16a	UTSW	2	26438571	missense	probably benign	0.00
R6459:Sec16a	UTSW	2	26423500	missense	probably benign	0.04
R6520:Sec16a	UTSW	2	26426106	missense	probably damaging	1.00
R6631:Sec16a	UTSW	2	26439957	missense	probably damaging	1.00
R6657:Sec16a	UTSW	2	26425864	nonsense	probably null
R6750:Sec16a	UTSW	2	26440018	missense	probably benign	0.00
R6852:Sec16a	UTSW	2	26441419	missense	probably damaging	0.99
R6860:Sec16a	UTSW	2	26430112	missense	probably damaging	1.00
R6967:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6968:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6970:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6991:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6993:Sec16a	UTSW	2	26423574	missense	probably damaging	0.99
R7009:Sec16a	UTSW	2	26436002	nonsense	probably null
R7057:Sec16a	UTSW	2	26425265	missense	probably damaging	1.00
R7186:Sec16a	UTSW	2	26440703	nonsense	probably null
R7227:Sec16a	UTSW	2	26438923	missense	probably benign	0.01
R7234:Sec16a	UTSW	2	26439768	missense	probably damaging	1.00
R7259:Sec16a	UTSW	2	26441592	missense	probably benign	0.00
R7326:Sec16a	UTSW	2	26439717	missense	unknown
R7371:Sec16a	UTSW	2	26441722	missense	probably benign
R7388:Sec16a	UTSW	2	26428364	missense
R7414:Sec16a	UTSW	2	26423631	missense
R7417:Sec16a	UTSW	2	26421397	missense
R7501:Sec16a	UTSW	2	26441851	missense	probably damaging	1.00
R7558:Sec16a	UTSW	2	26439734	missense
R7696:Sec16a	UTSW	2	26415633	critical splice donor site	probably null
R7981:Sec16a	UTSW	2	26421372	critical splice donor site	probably null
R8117:Sec16a	UTSW	2	26441429	missense	probably benign	0.00
R8131:Sec16a	UTSW	2	26410946	missense
R8163:Sec16a	UTSW	2	26416421	missense
R8825:Sec16a	UTSW	2	26423574	missense
R8855:Sec16a	UTSW	2	26439840	missense	probably benign	0.16
R9165:Sec16a	UTSW	2	26423633	missense
R9216:Sec16a	UTSW	2	26414389	missense
R9283:Sec16a	UTSW	2	26423892	missense
R9506:Sec16a	UTSW	2	26429372	critical splice donor site	probably null
R9581:Sec16a	UTSW	2	26438635	missense
X0011:Sec16a	UTSW	2	26415643	missense	probably damaging	1.00
X0034:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
X0062:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
Z1088:Sec16a	UTSW	2	26439093	missense	probably damaging	0.99
Z1176:Sec16a	UTSW	2	26438748	missense
Z1177:Sec16a	UTSW	2	26439321	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTCTACCCAGAGTGTGAAGGTAC -3'
(R):5'- CATTCTGAGCTTAGGCAGGAGG -3'

Sequencing Primer
(F):5'- GCCCTATAAACCTGAGCT -3'
(R):5'- CCTGAGCTGGGTCTAGAAGC -3'

Posted On

2015-10-08