Mutagenetix > Incidental Mutations

Incidental Mutation 'R4627:Ralgapa2'

348836

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa2

Ensembl Gene

ENSMUSG00000037110

Gene Name

Ral GTPase activating protein, alpha subunit 2 (catalytic)

Synonyms

AS250, RGC2, A230067G21Rik

MMRRC Submission

041892-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R4627 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146239879-146512344 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 146361453 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1159 (S1159P)

Ref Sequence

ENSEMBL: ENSMUSP00000153734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]

AlphaFold

A3KGS3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109986
AA Change: S1112P

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: S1112P

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	1017	1028	N/A	INTRINSIC
low complexity region	1296	1301	N/A	INTRINSIC
Pfam:Rap_GAP	1701	1877	6.8e-48	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131824
AA Change: S1074P

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: S1074P

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	979	990	N/A	INTRINSIC
low complexity region	1258	1263	N/A	INTRINSIC
Pfam:Rap_GAP	1663	1842	1.3e-66	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000146307
AA Change: S100P

SMART Domains

Protein: ENSMUSP00000114547
Gene: ENSMUSG00000037110
AA Change: S100P

Domain	Start	End	E-Value	Type
low complexity region	6	17	N/A	INTRINSIC
low complexity region	285	290	N/A	INTRINSIC
Pfam:Rap_GAP	690	830	4.9e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148784

Predicted Effect

unknown
Transcript: ENSMUST00000149499
AA Change: S744P

SMART Domains

Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110
AA Change: S744P

Domain	Start	End	E-Value	Type
low complexity region	140	151	N/A	INTRINSIC
low complexity region	650	661	N/A	INTRINSIC
low complexity region	929	934	N/A	INTRINSIC
Pfam:Rap_GAP	1334	1511	2.4e-48	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228797
AA Change: S1159P

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,068,092	S393P	probably benign	Het
Adam6a	A	T	12: 113,544,949	D314V	probably benign	Het
Adamts18	C	T	8: 113,773,168	W371*	probably null	Het
Adamtsl2	T	A	2: 27,093,585	L331Q	probably damaging	Het
Akr1c13	G	T	13: 4,197,870	V214F	probably damaging	Het
Aldoart1	T	C	4: 72,852,443	T43A	probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ano7	T	C	1: 93,375,185	I15T	probably benign	Het
Aox3	A	T	1: 58,125,035	T155S	probably damaging	Het
Ap2a1	C	T	7: 44,904,419	V535M	probably damaging	Het
Apbb2	C	T	5: 66,400,076		probably null	Het
Astn1	C	A	1: 158,502,251	H225Q	possibly damaging	Het
Atm	A	G	9: 53,456,506	I2439T	possibly damaging	Het
Atp1b2	T	A	11: 69,601,334	I263F	probably damaging	Het
Ccdc184	A	T	15: 98,168,757	N148Y	probably benign	Het
Cdca7	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	2: 72,481,861		probably benign	Het
Cep192	C	G	18: 67,812,369	P180R	probably benign	Het
Cfap46	T	C	7: 139,657,281	Y571C	probably damaging	Het
Cfap46	A	T	7: 139,680,927	L85Q	probably damaging	Het
Chchd6	G	A	6: 89,384,660	L226F	probably damaging	Het
Cnot6l	A	G	5: 96,077,211	V541A	probably benign	Het
Cobl	T	C	11: 12,251,093	E1214G	probably damaging	Het
Cpsf2	G	A	12: 101,989,895	R319Q	probably benign	Het
Csdc2	T	C	15: 81,949,123	V107A	probably benign	Het
Csmd1	A	G	8: 16,697,917	W273R	probably benign	Het
Diexf	T	C	1: 193,107,695	T719A	probably benign	Het
Dnah2	T	A	11: 69,465,376	N2156I	probably damaging	Het
Dsp	A	G	13: 38,168,641	Y165C	probably benign	Het
Exoc1	T	C	5: 76,542,228	V205A	probably benign	Het
Fam98c	T	C	7: 29,155,268	T49A	possibly damaging	Het
Fbln2	G	T	6: 91,259,767	V755L	probably damaging	Het
Fhad1	A	T	4: 141,896,468	V1371D	possibly damaging	Het
Folh1	A	T	7: 86,773,252	M59K	probably benign	Het
Foxf2	A	T	13: 31,626,888	H270L	probably benign	Het
Gm14401	G	A	2: 177,086,316	R65H	probably benign	Het
Gpn1	C	A	5: 31,498,393	Y592*	probably null	Het
Hmcn1	T	G	1: 150,595,894	D4903A	probably benign	Het
Hnf1a	T	C	5: 114,955,871	R220G	probably damaging	Het
Hoxd10	G	A	2: 74,692,292	A105T	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kidins220	C	T	12: 25,057,042	T1498I	possibly damaging	Het
Klhl2	G	T	8: 64,758,191	Y274*	probably null	Het
Lmbrd1	A	G	1: 24,705,999	Y140C	probably damaging	Het
Mapk8ip3	G	A	17: 24,903,293	T706I	probably benign	Het
Mast4	A	C	13: 103,334,021	S58A	possibly damaging	Het
Mcm6	T	C	1: 128,351,548	D167G	probably benign	Het
Mmachc	A	T	4: 116,703,471	S276T	probably damaging	Het
Nfat5	A	T	8: 107,369,276	Q1289L	probably damaging	Het
Nlrc4	G	T	17: 74,446,628	F253L	probably damaging	Het
Nr1i3	C	A	1: 171,216,445	A112E	probably benign	Het
Olfr1367	T	C	13: 21,347,464	F179L	probably damaging	Het
Olfr45	T	A	7: 140,691,378	S158T	probably benign	Het
Olfr455	T	A	6: 42,538,441	T194S	possibly damaging	Het
Olfr853	G	T	9: 19,537,673	Q86K	possibly damaging	Het
Orc5	G	T	5: 22,548,005	F10L	probably benign	Het
Pde10a	A	C	17: 8,981,652	D779A	probably damaging	Het
Pde4b	T	C	4: 102,601,605	L486S	probably damaging	Het
Pex2	A	T	3: 5,561,281	I156N	probably damaging	Het
Phtf2	C	T	5: 20,773,740	R63Q	probably damaging	Het
Prag1	A	G	8: 36,103,292	Y343C	probably damaging	Het
Prdm16	A	T	4: 154,367,240	Y170N	probably damaging	Het
Prpf6	A	C	2: 181,601,474	K5T	probably damaging	Het
Ptpn1	A	G	2: 167,967,781	K103R	probably benign	Het
Rapgef3	G	T	15: 97,758,929	D318E	probably damaging	Het
Ripk4	A	T	16: 97,744,026	S474T	probably damaging	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Sec16a	A	G	2: 26,429,393	V1491A	probably damaging	Het
Sec16a	C	T	2: 26,431,068		probably null	Het
Setd7	G	T	3: 51,542,665	N113K	probably damaging	Het
Shank2	C	T	7: 144,411,424	T1502M	probably damaging	Het
Skor1	A	T	9: 63,145,476	C376S	probably damaging	Het
Slc12a3	A	T	8: 94,329,384	L49F	probably benign	Het
Slc35d3	C	T	10: 19,849,331	V260M	probably damaging	Het
Slc46a1	T	A	11: 78,466,889	V256E	probably benign	Het
Slc6a1	T	C	6: 114,308,106	S127P	probably benign	Het
Syngr4	A	G	7: 45,887,028	L190P	probably damaging	Het
Tagap	G	A	17: 7,926,941		probably null	Het
Tamm41	A	T	6: 115,035,002	N89K	probably benign	Het
Tbc1d31	T	A	15: 57,967,912	M922K	probably benign	Het
Tbk1	T	C	10: 121,568,080	N254S	possibly damaging	Het
Tfec	A	G	6: 16,840,479	S140P	probably damaging	Het
Tnrc18	T	C	5: 142,740,128	E1802G	unknown	Het
Tom1l2	C	T	11: 60,242,707		probably null	Het
Tonsl	T	G	15: 76,637,224	K323Q	probably damaging	Het
Tsnaxip1	A	T	8: 105,841,407	E268D	probably damaging	Het
Ttf1	C	A	2: 29,065,160	H179N	possibly damaging	Het
Ttn	T	C	2: 76,726,173	S30163G	probably damaging	Het
Ube2c	A	G	2: 164,772,173	N143S	possibly damaging	Het
Ugt1a10	G	A	1: 88,218,390	R519Q	probably damaging	Het
Vmn2r9	T	C	5: 108,847,597	Y395C	probably damaging	Het
Vwa8	G	A	14: 79,103,697		probably null	Het
Zfp9	A	G	6: 118,464,976	Y242H	probably damaging	Het

Other mutations in Ralgapa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Ralgapa2	APN	2	146485136	missense	possibly damaging	0.61
IGL00915:Ralgapa2	APN	2	146342522	missense	probably damaging	1.00
IGL01012:Ralgapa2	APN	2	146421739	missense	possibly damaging	0.95
IGL01018:Ralgapa2	APN	2	146410193	missense	probably benign	0.02
IGL01018:Ralgapa2	APN	2	146410192	missense	probably benign	0.00
IGL01902:Ralgapa2	APN	2	146315014	missense	probably damaging	1.00
IGL02160:Ralgapa2	APN	2	146348440	splice site	probably benign
IGL02321:Ralgapa2	APN	2	146412816	nonsense	probably null
IGL02412:Ralgapa2	APN	2	146412132	missense	probably damaging	0.96
IGL03026:Ralgapa2	APN	2	146460775	splice site	probably benign
IGL03115:Ralgapa2	APN	2	146424814	missense	probably damaging	0.99
IGL03256:Ralgapa2	APN	2	146460712	critical splice donor site	probably null
IGL03379:Ralgapa2	APN	2	146357987	missense	probably benign	0.01
Chow	UTSW	2	146346718	nonsense	probably null
purina	UTSW	2	146333486	missense	probably damaging	1.00
P4748:Ralgapa2	UTSW	2	146346811	nonsense	probably null
R0012:Ralgapa2	UTSW	2	146412752	missense	probably benign
R0012:Ralgapa2	UTSW	2	146412752	missense	probably benign
R0165:Ralgapa2	UTSW	2	146388487	splice site	probably benign
R0344:Ralgapa2	UTSW	2	146346794	missense	possibly damaging	0.69
R0402:Ralgapa2	UTSW	2	146434809	missense	probably damaging	0.98
R0419:Ralgapa2	UTSW	2	146428672	missense	possibly damaging	0.69
R0638:Ralgapa2	UTSW	2	146342192	missense	probably benign	0.00
R0704:Ralgapa2	UTSW	2	146451784	missense	probably damaging	1.00
R0722:Ralgapa2	UTSW	2	146388531	missense	probably damaging	1.00
R0866:Ralgapa2	UTSW	2	146436003	missense	probably damaging	1.00
R1065:Ralgapa2	UTSW	2	146450558	missense	probably benign	0.00
R1212:Ralgapa2	UTSW	2	146357982	missense	probably benign	0.00
R1395:Ralgapa2	UTSW	2	146388500	missense	probably damaging	1.00
R1614:Ralgapa2	UTSW	2	146388612	missense	probably damaging	1.00
R1686:Ralgapa2	UTSW	2	146358000	missense	probably benign	0.09
R1799:Ralgapa2	UTSW	2	146342728	missense	probably benign	0.02
R1905:Ralgapa2	UTSW	2	146387701	missense	probably damaging	1.00
R1956:Ralgapa2	UTSW	2	146460759	missense	probably benign	0.00
R2144:Ralgapa2	UTSW	2	146388604	missense	probably damaging	1.00
R2148:Ralgapa2	UTSW	2	146431887	missense	probably benign	0.02
R2219:Ralgapa2	UTSW	2	146421679	missense	probably benign	0.09
R2220:Ralgapa2	UTSW	2	146421679	missense	probably benign	0.09
R2261:Ralgapa2	UTSW	2	146342683	missense	probably damaging	1.00
R2402:Ralgapa2	UTSW	2	146353192	missense	probably damaging	1.00
R2495:Ralgapa2	UTSW	2	146361400	missense	possibly damaging	0.82
R3752:Ralgapa2	UTSW	2	146421631	missense	possibly damaging	0.94
R3953:Ralgapa2	UTSW	2	146435964	missense	probably damaging	1.00
R3956:Ralgapa2	UTSW	2	146435964	missense	probably damaging	1.00
R4177:Ralgapa2	UTSW	2	146485163	missense	probably damaging	1.00
R4182:Ralgapa2	UTSW	2	146435994	missense	probably damaging	1.00
R4193:Ralgapa2	UTSW	2	146342573	missense	probably damaging	1.00
R4332:Ralgapa2	UTSW	2	146260368	missense	probably benign	0.10
R4507:Ralgapa2	UTSW	2	146353248	missense	probably benign	0.11
R4574:Ralgapa2	UTSW	2	146435999	missense	probably damaging	1.00
R4585:Ralgapa2	UTSW	2	146315024	missense	probably damaging	0.99
R4647:Ralgapa2	UTSW	2	146387629	missense	possibly damaging	0.69
R4677:Ralgapa2	UTSW	2	146345467	missense	possibly damaging	0.82
R4724:Ralgapa2	UTSW	2	146345533	missense	possibly damaging	0.46
R4760:Ralgapa2	UTSW	2	146346749	missense	probably benign	0.00
R4831:Ralgapa2	UTSW	2	146405067	intron	probably benign
R4962:Ralgapa2	UTSW	2	146434834	nonsense	probably null
R4993:Ralgapa2	UTSW	2	146447311	missense	probably damaging	1.00
R5041:Ralgapa2	UTSW	2	146485151	missense	probably benign	0.00
R5120:Ralgapa2	UTSW	2	146412084	missense	probably benign	0.26
R5185:Ralgapa2	UTSW	2	146388486	splice site	probably null
R5393:Ralgapa2	UTSW	2	146345455	missense	probably damaging	1.00
R5428:Ralgapa2	UTSW	2	146334494	missense	probably damaging	0.96
R5439:Ralgapa2	UTSW	2	146342510	missense	probably benign	0.08
R5476:Ralgapa2	UTSW	2	146447436	missense	probably benign
R5695:Ralgapa2	UTSW	2	146333477	missense	probably damaging	1.00
R5705:Ralgapa2	UTSW	2	146449273	missense	probably damaging	1.00
R5718:Ralgapa2	UTSW	2	146453406	splice site	probably null
R5817:Ralgapa2	UTSW	2	146333486	missense	probably damaging	1.00
R5877:Ralgapa2	UTSW	2	146388569	missense	probably damaging	1.00
R5994:Ralgapa2	UTSW	2	146361453	missense	probably benign	0.00
R6048:Ralgapa2	UTSW	2	146434845	missense	possibly damaging	0.46
R6158:Ralgapa2	UTSW	2	146424676	missense	possibly damaging	0.69
R6169:Ralgapa2	UTSW	2	146450465	missense	probably damaging	1.00
R6280:Ralgapa2	UTSW	2	146342209	missense	probably damaging	1.00
R6301:Ralgapa2	UTSW	2	146327411	missense	possibly damaging	0.94
R6650:Ralgapa2	UTSW	2	146388502	missense	probably damaging	1.00
R6959:Ralgapa2	UTSW	2	146342701	missense	probably damaging	0.98
R7020:Ralgapa2	UTSW	2	146346718	nonsense	probably null
R7035:Ralgapa2	UTSW	2	146511857	missense	probably damaging	1.00
R7167:Ralgapa2	UTSW	2	146348454	missense	probably benign
R7186:Ralgapa2	UTSW	2	146388486	splice site	probably null
R7252:Ralgapa2	UTSW	2	146342751	critical splice acceptor site	probably null
R7266:Ralgapa2	UTSW	2	146334568	missense	probably damaging	1.00
R7371:Ralgapa2	UTSW	2	146347126	missense	probably benign	0.05
R7432:Ralgapa2	UTSW	2	146434856	missense	probably benign	0.41
R7470:Ralgapa2	UTSW	2	146424667	missense	probably damaging	1.00
R7663:Ralgapa2	UTSW	2	146418415	missense	probably benign	0.01
R7780:Ralgapa2	UTSW	2	146342414	missense	probably benign	0.14
R7973:Ralgapa2	UTSW	2	146388561	missense	possibly damaging	0.88
R8018:Ralgapa2	UTSW	2	146340391	missense	probably damaging	1.00
R8063:Ralgapa2	UTSW	2	146443855	missense	probably damaging	1.00
R8070:Ralgapa2	UTSW	2	146353279	missense	probably damaging	0.98
R8264:Ralgapa2	UTSW	2	146333450	missense	possibly damaging	0.90
R8309:Ralgapa2	UTSW	2	146404866	missense	possibly damaging	0.66
R8409:Ralgapa2	UTSW	2	146244977	missense
R8474:Ralgapa2	UTSW	2	146424830	missense	probably damaging	1.00
R8487:Ralgapa2	UTSW	2	146388543	missense	probably damaging	1.00
R8492:Ralgapa2	UTSW	2	146342604	missense	possibly damaging	0.50
R8733:Ralgapa2	UTSW	2	146424763	missense	probably damaging	1.00
R8856:Ralgapa2	UTSW	2	146342219	missense	probably benign	0.30
R8858:Ralgapa2	UTSW	2	146260365	critical splice donor site	probably null
R8862:Ralgapa2	UTSW	2	146424811	missense	probably benign	0.41
R9146:Ralgapa2	UTSW	2	146342332	missense	probably benign
R9324:Ralgapa2	UTSW	2	146460725	missense	probably damaging	1.00
R9439:Ralgapa2	UTSW	2	146412138	missense	probably benign
RF019:Ralgapa2	UTSW	2	146361503	missense	possibly damaging	0.53
X0019:Ralgapa2	UTSW	2	146388652	missense	possibly damaging	0.56
Z1088:Ralgapa2	UTSW	2	146434905	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- AGCCCAGTTTCACATCGCAC -3'
(R):5'- ACCATTGGAATTATGCATCCCC -3'

Sequencing Primer
(F):5'- CAGTTTCACATCGCACTAATGAGTC -3'
(R):5'- GGAATTATGCATCCCCCGTAC -3'

Posted On

2015-10-08