Mutagenetix > Incidental Mutation

Incidental Mutation 'R0265:Klhl6'

34884

Institutional Source

Beutler Lab

Gene Symbol

Klhl6

Ensembl Gene

ENSMUSG00000043008

Gene Name

kelch-like 6

Synonyms

MMRRC Submission

038491-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R0265 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19946496-19983037 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19948234 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 470 (V470A)

Ref Sequence

ENSEMBL: ENSMUSP00000053023 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058839]

AlphaFold

Q6V595

Predicted Effect

probably benign
Transcript: ENSMUST00000058839
AA Change: V470A

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000053023
Gene: ENSMUSG00000043008
AA Change: V470A

Domain	Start	End	E-Value	Type
BTB	70	167	1.43e-25	SMART
BACK	172	274	1.68e-35	SMART
Kelch	376	419	3.05e-1	SMART
Kelch	420	466	6.82e-11	SMART
Kelch	467	514	4.27e-3	SMART
Kelch	515	556	3.06e-4	SMART
Kelch	557	604	3.47e-3	SMART

Meta Mutation Damage Score

0.1876

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.6%
20x: 92.0%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	G	14: 8,431,667	Y655S	probably damaging	Het
9330182L06Rik	T	C	5: 9,434,681	L486P	probably damaging	Het
Abca14	A	G	7: 120,223,627	I321V	probably benign	Het
Adcy7	A	G	8: 88,324,763	D837G	probably damaging	Het
Aldh1a1	T	A	19: 20,640,076	Y457*	probably null	Het
Alox5	T	C	6: 116,420,362	Y287C	probably benign	Het
Ano8	T	C	8: 71,480,524		probably benign	Het
Ap3b1	A	G	13: 94,493,681	K815E	unknown	Het
Atp11a	A	T	8: 12,856,930		probably benign	Het
Atp6v0a1	A	T	11: 101,048,515	D702V	possibly damaging	Het
Cacna1b	T	A	2: 24,761,844	N108Y	probably damaging	Het
Ccdc57	G	C	11: 120,921,811	A39G	probably benign	Het
Cdhr1	A	T	14: 37,081,376	V581D	probably benign	Het
Cyp2b23	A	G	7: 26,672,879		probably benign	Het
D430041D05Rik	G	C	2: 104,167,950	P1836R	probably damaging	Het
Ddit4l	C	T	3: 137,624,287		probably benign	Het
Dnah8	A	T	17: 30,690,271	I1024F	probably benign	Het
Edc3	T	A	9: 57,727,338	F213I	probably damaging	Het
Edrf1	G	A	7: 133,657,045	D717N	probably damaging	Het
Efna5	G	A	17: 62,651,073	P63S	probably damaging	Het
Entpd3	A	G	9: 120,558,481	Y248C	probably damaging	Het
Flcn	G	A	11: 59,795,809	Q373*	probably null	Het
Fry	T	C	5: 150,434,776	V1908A	probably damaging	Het
Gabrg3	A	T	7: 57,381,617	Y58*	probably null	Het
Gabrp	A	T	11: 33,552,614	Y417N	probably damaging	Het
Golga2	C	A	2: 32,304,952		probably null	Het
Grip2	C	A	6: 91,773,792		probably null	Het
Gsx2	A	G	5: 75,077,068	Y227C	probably damaging	Het
Hif3a	T	C	7: 17,035,868	*665W	probably null	Het
Hist1h2aa	T	C	13: 23,934,649	V63A	probably benign	Het
Hsd3b1	C	A	3: 98,852,773	V301L	probably damaging	Het
Ifitm5	T	C	7: 140,950,008		probably benign	Het
Inpp4a	A	T	1: 37,378,986	D498V	probably damaging	Het
Itga1	A	T	13: 114,992,459	D554E	probably benign	Het
Itk	G	A	11: 46,389,458		probably benign	Het
Kdm3b	T	A	18: 34,795,663		probably benign	Het
Lamb3	T	A	1: 193,320,531	W95R	probably damaging	Het
Lbhd2	T	A	12: 111,410,242	I41N	probably damaging	Het
Lrp4	A	T	2: 91,490,670	S1014C	probably damaging	Het
Ltbp2	C	T	12: 84,785,969		probably null	Het
Map3k19	A	G	1: 127,822,182	I1144T	possibly damaging	Het
Mfsd10	T	C	5: 34,635,163		probably benign	Het
Mocos	A	G	18: 24,666,276	D189G	probably benign	Het
Mvb12a	T	A	8: 71,547,010	F224L	probably damaging	Het
Myo15	A	T	11: 60,514,897		probably null	Het
Nos2	A	T	11: 78,937,602	H249L	probably damaging	Het
Notum	A	G	11: 120,658,334	M184T	probably benign	Het
Nvl	C	A	1: 181,134,830	D192Y	probably damaging	Het
Olfr1024	T	A	2: 85,904,247	N269I	probably benign	Het
Olfr1065	C	A	2: 86,445,959	V8L	probably benign	Het
Olfr1308	T	C	2: 111,960,494	Y193C	probably damaging	Het
Olfr204	A	T	16: 59,315,071	F112Y	probably damaging	Het
Olfr218	A	G	1: 173,203,917	K187R	probably benign	Het
Osgin1	A	G	8: 119,445,657	I397V	possibly damaging	Het
Otulin	A	G	15: 27,616,424	V123A	probably damaging	Het
P4ha1	A	G	10: 59,348,259	Y181C	probably damaging	Het
Pcdhgc5	A	T	18: 37,821,350	D559V	probably damaging	Het
Phf2	T	C	13: 48,828,794	N151S	unknown	Het
Plxnc1	C	A	10: 94,813,129	G1263C	probably benign	Het
Rad51ap1	A	G	6: 126,924,197	*338Q	probably null	Het
Raver1	A	G	9: 21,075,659	S676P	probably benign	Het
Rfx8	T	C	1: 39,688,577	E196G	possibly damaging	Het
Rreb1	A	T	13: 37,916,155	K187*	probably null	Het
Rxfp1	T	C	3: 79,667,654	T217A	probably benign	Het
Rxra	T	C	2: 27,752,430	L305P	probably damaging	Het
Sardh	T	C	2: 27,227,066		probably benign	Het
Skor2	A	T	18: 76,876,598	E952D	probably damaging	Het
Slc22a29	A	T	19: 8,169,970	S343T	probably benign	Het
Sorbs2	T	C	8: 45,785,337		probably benign	Het
Supt7l	C	T	5: 31,515,918	V329I	probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tac1	T	C	6: 7,559,165		probably benign	Het
Tcn2	A	T	11: 3,922,044	V361D	probably damaging	Het
Tm2d3	G	A	7: 65,697,834	A170T	possibly damaging	Het
Tnks	G	A	8: 34,839,970	R1142*	probably null	Het
Ttll7	C	A	3: 146,944,160	Y648*	probably null	Het
Umod	G	T	7: 119,466,073	Q578K	probably benign	Het
Upf2	G	A	2: 6,027,204		probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Washc5	A	G	15: 59,338,960	I1013T	probably benign	Het
Wdr60	T	C	12: 116,257,406		probably benign	Het
Zfp704	C	A	3: 9,565,157	R48L	probably damaging	Het

Other mutations in Klhl6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Klhl6	APN	16	19957062	missense	probably benign	0.00
IGL01465:Klhl6	APN	16	19982822	missense	probably damaging	0.98
IGL01831:Klhl6	APN	16	19953485	missense	probably damaging	1.00
IGL01971:Klhl6	APN	16	19949526	missense	probably damaging	0.99
IGL02532:Klhl6	APN	16	19957082	missense	possibly damaging	0.84
IGL03113:Klhl6	APN	16	19957251	missense	possibly damaging	0.68
IGL03290:Klhl6	APN	16	19947137	missense	probably benign	0.44
Ascension	UTSW	16	19947098	missense	probably damaging	1.00
besmirched	UTSW	16	19949447	splice site	probably null
blau	UTSW	16	19957005	missense	probably damaging	1.00
blossom	UTSW	16	19957139	missense	probably damaging	1.00
Breech	UTSW	16	19948234	missense	probably benign	0.43
cerulean	UTSW	16	19957218	nonsense	probably null
cobalt	UTSW	16	19957022	missense	probably damaging	1.00
grossbeak	UTSW	16	19949451	missense	probably null	1.00
heights	UTSW	16	19957028	missense	probably damaging	0.98
Lazuli	UTSW	16	19956966	frame shift	probably null
Parula	UTSW	16	19957043	missense	possibly damaging	0.56
sideways	UTSW	16	19957268	missense	probably damaging	0.99
torres_del_paine	UTSW	16	19948127	missense	probably damaging	1.00
turquoise	UTSW	16	19982796	missense	probably damaging	1.00
IGL03046:Klhl6	UTSW	16	19982889	missense	probably benign
R0496:Klhl6	UTSW	16	19956966	frame shift	probably null
R0497:Klhl6	UTSW	16	19956966	frame shift	probably null
R0540:Klhl6	UTSW	16	19957014	missense	possibly damaging	0.95
R0541:Klhl6	UTSW	16	19949447	splice site	probably null
R0554:Klhl6	UTSW	16	19953593	missense	probably damaging	0.96
R0607:Klhl6	UTSW	16	19957014	missense	possibly damaging	0.95
R0636:Klhl6	UTSW	16	19948073	splice site	probably benign
R0670:Klhl6	UTSW	16	19949559	missense	possibly damaging	0.92
R1477:Klhl6	UTSW	16	19965977	missense	probably benign	0.00
R1510:Klhl6	UTSW	16	19947098	missense	probably damaging	1.00
R1547:Klhl6	UTSW	16	19966082	missense	probably benign
R1747:Klhl6	UTSW	16	19947028	missense	probably benign	0.40
R1871:Klhl6	UTSW	16	19957043	missense	possibly damaging	0.56
R1966:Klhl6	UTSW	16	19982822	missense	probably damaging	0.98
R2058:Klhl6	UTSW	16	19982931	missense	probably benign
R4466:Klhl6	UTSW	16	19957268	missense	probably damaging	0.99
R4645:Klhl6	UTSW	16	19947147	missense	probably damaging	1.00
R4690:Klhl6	UTSW	16	19957284	missense	probably benign	0.44
R4824:Klhl6	UTSW	16	19957028	missense	probably damaging	0.98
R4833:Klhl6	UTSW	16	19957139	missense	probably damaging	1.00
R4835:Klhl6	UTSW	16	19957033	missense	probably benign	0.07
R5001:Klhl6	UTSW	16	19946991	makesense	probably null
R5475:Klhl6	UTSW	16	19948127	missense	probably damaging	1.00
R5700:Klhl6	UTSW	16	19957218	nonsense	probably null
R5867:Klhl6	UTSW	16	19982820	missense	probably benign	0.37
R5910:Klhl6	UTSW	16	19957094	missense	probably benign	0.04
R6992:Klhl6	UTSW	16	19953587	missense	probably damaging	1.00
R7082:Klhl6	UTSW	16	19982883	missense	probably benign	0.00
R7262:Klhl6	UTSW	16	19982796	missense	probably damaging	1.00
R7314:Klhl6	UTSW	16	19957005	missense	probably damaging	1.00
R7464:Klhl6	UTSW	16	19957113	missense	possibly damaging	0.58
R7688:Klhl6	UTSW	16	19947131	missense	probably damaging	1.00
R7957:Klhl6	UTSW	16	19949451	missense	probably null	1.00
R8319:Klhl6	UTSW	16	19957190	missense	possibly damaging	0.74
R8460:Klhl6	UTSW	16	19957031	missense	probably damaging	1.00
R8853:Klhl6	UTSW	16	19947229	missense	possibly damaging	0.52
R9046:Klhl6	UTSW	16	19947053	missense	probably damaging	1.00
R9160:Klhl6	UTSW	16	19957022	missense	probably damaging	1.00
Z1176:Klhl6	UTSW	16	19953674	missense	probably damaging	1.00
Z1177:Klhl6	UTSW	16	19982961	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCAGGACTTCTAGGGAAATCCCAC -3'
(R):5'- ACAGCCAATGCACAGCTTGCTC -3'

Sequencing Primer
(F):5'- GGCTACAGATATGTAAGAAGTCATCC -3'
(R):5'- TTCCCAGAGCCTAAAAAGATGGTG -3'

Posted On

2013-05-09