Incidental Mutation 'R4627:Prdm16'
ID348848
Institutional Source Beutler Lab
Gene Symbol Prdm16
Ensembl Gene ENSMUSG00000039410
Gene NamePR domain containing 16
SynonymsMel1, 5730557K01Rik, csp1, line 27
MMRRC Submission 041892-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R4627 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location154316125-154636873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154367240 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 170 (Y170N)
Ref Sequence ENSEMBL: ENSMUSP00000117598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030902] [ENSMUST00000070313] [ENSMUST00000097759] [ENSMUST00000105636] [ENSMUST00000105637] [ENSMUST00000105638] [ENSMUST00000124771]
Predicted Effect probably damaging
Transcript: ENSMUST00000030902
AA Change: Y171N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030902
Gene: ENSMUSG00000039410
AA Change: Y171N

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 951 973 5.29e-5 SMART
ZnF_C2H2 979 1002 1.6e-4 SMART
ZnF_C2H2 1008 1030 7.26e-3 SMART
low complexity region 1116 1132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070313
AA Change: Y172N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064546
Gene: ENSMUSG00000039410
AA Change: Y172N

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 218 8.75e-5 SMART
ZnF_C2H2 231 251 2.82e1 SMART
low complexity region 261 275 N/A INTRINSIC
ZnF_C2H2 283 305 1.04e-3 SMART
ZnF_C2H2 311 333 1.6e-4 SMART
ZnF_C2H2 339 362 3.95e-4 SMART
ZnF_C2H2 368 390 1.95e-3 SMART
ZnF_C2H2 396 418 8.22e-2 SMART
ZnF_C2H2 425 452 9.96e0 SMART
low complexity region 497 518 N/A INTRINSIC
low complexity region 521 541 N/A INTRINSIC
low complexity region 611 642 N/A INTRINSIC
ZnF_C2H2 953 975 5.29e-5 SMART
ZnF_C2H2 981 1004 1.6e-4 SMART
ZnF_C2H2 1010 1032 7.26e-3 SMART
low complexity region 1118 1134 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097759
AA Change: Y171N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095365
Gene: ENSMUSG00000039410
AA Change: Y171N

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105636
AA Change: Y172N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101261
Gene: ENSMUSG00000039410
AA Change: Y172N

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 218 8.75e-5 SMART
ZnF_C2H2 231 251 2.82e1 SMART
low complexity region 261 275 N/A INTRINSIC
ZnF_C2H2 283 305 1.04e-3 SMART
ZnF_C2H2 311 333 1.6e-4 SMART
ZnF_C2H2 339 362 3.95e-4 SMART
ZnF_C2H2 368 390 1.95e-3 SMART
ZnF_C2H2 396 418 8.22e-2 SMART
ZnF_C2H2 425 452 9.96e0 SMART
low complexity region 497 518 N/A INTRINSIC
low complexity region 521 541 N/A INTRINSIC
low complexity region 611 642 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105637
AA Change: Y170N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101262
Gene: ENSMUSG00000039410
AA Change: Y170N

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 216 8.75e-5 SMART
ZnF_C2H2 229 249 2.82e1 SMART
low complexity region 259 273 N/A INTRINSIC
ZnF_C2H2 281 303 1.04e-3 SMART
ZnF_C2H2 309 331 1.6e-4 SMART
ZnF_C2H2 337 360 3.95e-4 SMART
ZnF_C2H2 366 388 1.95e-3 SMART
ZnF_C2H2 394 416 8.22e-2 SMART
ZnF_C2H2 423 450 9.96e0 SMART
low complexity region 495 516 N/A INTRINSIC
low complexity region 519 539 N/A INTRINSIC
low complexity region 609 640 N/A INTRINSIC
ZnF_C2H2 950 972 5.29e-5 SMART
ZnF_C2H2 978 1001 1.6e-4 SMART
ZnF_C2H2 1007 1029 7.26e-3 SMART
low complexity region 1115 1131 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105638
AA Change: Y171N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101263
Gene: ENSMUSG00000039410
AA Change: Y171N

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124771
AA Change: Y170N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117598
Gene: ENSMUSG00000039410
AA Change: Y170N

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 213 8.04e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141164
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reciprocal translocation t(1;3)(p36;q21) occurs in a subset of myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). This gene is located near the 1p36.3 breakpoint and has been shown to be specifically expressed in the t(1:3)(p36,q21)-positive MDS/AML. The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal PR domain. The translocation results in the overexpression of a truncated version of this protein that lacks the PR domain, which may play an important role in the pathogenesis of MDS and AML. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice exhibit a cleft secondary palate, whitening of brown adipose tissue in older or fed a high-fat diet, and impaired adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Adam6a A T 12: 113,544,949 D314V probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Adamtsl2 T A 2: 27,093,585 L331Q probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Aldoart1 T C 4: 72,852,443 T43A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ano7 T C 1: 93,375,185 I15T probably benign Het
Aox3 A T 1: 58,125,035 T155S probably damaging Het
Ap2a1 C T 7: 44,904,419 V535M probably damaging Het
Apbb2 C T 5: 66,400,076 probably null Het
Astn1 C A 1: 158,502,251 H225Q possibly damaging Het
Atm A G 9: 53,456,506 I2439T possibly damaging Het
Atp1b2 T A 11: 69,601,334 I263F probably damaging Het
Ccdc184 A T 15: 98,168,757 N148Y probably benign Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Cep192 C G 18: 67,812,369 P180R probably benign Het
Cfap46 T C 7: 139,657,281 Y571C probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chchd6 G A 6: 89,384,660 L226F probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cobl T C 11: 12,251,093 E1214G probably damaging Het
Cpsf2 G A 12: 101,989,895 R319Q probably benign Het
Csdc2 T C 15: 81,949,123 V107A probably benign Het
Csmd1 A G 8: 16,697,917 W273R probably benign Het
Diexf T C 1: 193,107,695 T719A probably benign Het
Dnah2 T A 11: 69,465,376 N2156I probably damaging Het
Dsp A G 13: 38,168,641 Y165C probably benign Het
Exoc1 T C 5: 76,542,228 V205A probably benign Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fbln2 G T 6: 91,259,767 V755L probably damaging Het
Fhad1 A T 4: 141,896,468 V1371D possibly damaging Het
Folh1 A T 7: 86,773,252 M59K probably benign Het
Foxf2 A T 13: 31,626,888 H270L probably benign Het
Gm14401 G A 2: 177,086,316 R65H probably benign Het
Gpn1 C A 5: 31,498,393 Y592* probably null Het
Hmcn1 T G 1: 150,595,894 D4903A probably benign Het
Hnf1a T C 5: 114,955,871 R220G probably damaging Het
Hoxd10 G A 2: 74,692,292 A105T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 C T 12: 25,057,042 T1498I possibly damaging Het
Klhl2 G T 8: 64,758,191 Y274* probably null Het
Lmbrd1 A G 1: 24,705,999 Y140C probably damaging Het
Mapk8ip3 G A 17: 24,903,293 T706I probably benign Het
Mast4 A C 13: 103,334,021 S58A possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mmachc A T 4: 116,703,471 S276T probably damaging Het
Nfat5 A T 8: 107,369,276 Q1289L probably damaging Het
Nlrc4 G T 17: 74,446,628 F253L probably damaging Het
Nr1i3 C A 1: 171,216,445 A112E probably benign Het
Olfr1367 T C 13: 21,347,464 F179L probably damaging Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr455 T A 6: 42,538,441 T194S possibly damaging Het
Olfr853 G T 9: 19,537,673 Q86K possibly damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pde10a A C 17: 8,981,652 D779A probably damaging Het
Pde4b T C 4: 102,601,605 L486S probably damaging Het
Pex2 A T 3: 5,561,281 I156N probably damaging Het
Phtf2 C T 5: 20,773,740 R63Q probably damaging Het
Prag1 A G 8: 36,103,292 Y343C probably damaging Het
Prpf6 A C 2: 181,601,474 K5T probably damaging Het
Ptpn1 A G 2: 167,967,781 K103R probably benign Het
Ralgapa2 A G 2: 146,361,453 S1159P possibly damaging Het
Rapgef3 G T 15: 97,758,929 D318E probably damaging Het
Ripk4 A T 16: 97,744,026 S474T probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Sec16a A G 2: 26,429,393 V1491A probably damaging Het
Sec16a C T 2: 26,431,068 probably null Het
Setd7 G T 3: 51,542,665 N113K probably damaging Het
Shank2 C T 7: 144,411,424 T1502M probably damaging Het
Skor1 A T 9: 63,145,476 C376S probably damaging Het
Slc12a3 A T 8: 94,329,384 L49F probably benign Het
Slc35d3 C T 10: 19,849,331 V260M probably damaging Het
Slc46a1 T A 11: 78,466,889 V256E probably benign Het
Slc6a1 T C 6: 114,308,106 S127P probably benign Het
Syngr4 A G 7: 45,887,028 L190P probably damaging Het
Tagap G A 17: 7,926,941 probably null Het
Tamm41 A T 6: 115,035,002 N89K probably benign Het
Tbc1d31 T A 15: 57,967,912 M922K probably benign Het
Tbk1 T C 10: 121,568,080 N254S possibly damaging Het
Tfec A G 6: 16,840,479 S140P probably damaging Het
Tnrc18 T C 5: 142,740,128 E1802G unknown Het
Tom1l2 C T 11: 60,242,707 probably null Het
Tonsl T G 15: 76,637,224 K323Q probably damaging Het
Tsnaxip1 A T 8: 105,841,407 E268D probably damaging Het
Ttf1 C A 2: 29,065,160 H179N possibly damaging Het
Ttn T C 2: 76,726,173 S30163G probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Ugt1a10 G A 1: 88,218,390 R519Q probably damaging Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vwa8 G A 14: 79,103,697 probably null Het
Zfp9 A G 6: 118,464,976 Y242H probably damaging Het
Other mutations in Prdm16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Prdm16 APN 4 154341969 missense possibly damaging 0.89
IGL01517:Prdm16 APN 4 154328425 missense probably damaging 1.00
IGL01810:Prdm16 APN 4 154347927 missense probably benign 0.10
IGL02260:Prdm16 APN 4 154328287 missense probably benign 0.00
IGL02623:Prdm16 APN 4 154340877 missense probably damaging 0.98
IGL02744:Prdm16 APN 4 154345453 missense probably damaging 1.00
R0126:Prdm16 UTSW 4 154328838 splice site probably benign
R0345:Prdm16 UTSW 4 154341111 missense probably benign 0.09
R0365:Prdm16 UTSW 4 154342056 missense probably damaging 1.00
R0440:Prdm16 UTSW 4 154476627 splice site probably benign
R0899:Prdm16 UTSW 4 154528909 missense probably damaging 1.00
R1127:Prdm16 UTSW 4 154528799 missense probably damaging 1.00
R1546:Prdm16 UTSW 4 154528660 missense possibly damaging 0.94
R1803:Prdm16 UTSW 4 154335261 missense probably damaging 1.00
R2117:Prdm16 UTSW 4 154347925 missense probably null 0.99
R3814:Prdm16 UTSW 4 154328293 missense probably damaging 1.00
R4348:Prdm16 UTSW 4 154476667 missense probably benign 0.00
R4458:Prdm16 UTSW 4 154322308 missense probably benign
R4557:Prdm16 UTSW 4 154528827 missense probably benign 0.01
R4581:Prdm16 UTSW 4 154323353 missense probably damaging 1.00
R4584:Prdm16 UTSW 4 154337683 missense probably damaging 1.00
R4926:Prdm16 UTSW 4 154341552 missense possibly damaging 0.74
R5055:Prdm16 UTSW 4 154335262 missense possibly damaging 0.48
R5152:Prdm16 UTSW 4 154346102 missense probably damaging 0.99
R5257:Prdm16 UTSW 4 154367214 missense possibly damaging 0.89
R5258:Prdm16 UTSW 4 154367214 missense possibly damaging 0.89
R5368:Prdm16 UTSW 4 154345391 missense probably damaging 1.00
R5464:Prdm16 UTSW 4 154346144 critical splice acceptor site probably null
R5640:Prdm16 UTSW 4 154341910 missense probably benign
R5744:Prdm16 UTSW 4 154528704 missense probably damaging 1.00
R5892:Prdm16 UTSW 4 154323259 missense possibly damaging 0.74
R5938:Prdm16 UTSW 4 154347954 missense probably damaging 0.99
R6380:Prdm16 UTSW 4 154341367 missense probably benign 0.00
R6784:Prdm16 UTSW 4 154323307 missense probably damaging 1.00
R7097:Prdm16 UTSW 4 154345468 missense probably damaging 1.00
R7181:Prdm16 UTSW 4 154528637 missense probably damaging 1.00
R7197:Prdm16 UTSW 4 154341510 missense probably damaging 1.00
R7273:Prdm16 UTSW 4 154345453 missense probably damaging 1.00
R7379:Prdm16 UTSW 4 154528859 missense probably damaging 1.00
R7641:Prdm16 UTSW 4 154345444 missense probably damaging 1.00
R7704:Prdm16 UTSW 4 154341490 missense probably damaging 1.00
R7751:Prdm16 UTSW 4 154328299 missense probably damaging 1.00
R8048:Prdm16 UTSW 4 154320882 missense probably damaging 1.00
R8225:Prdm16 UTSW 4 154355245 critical splice donor site probably null
R8503:Prdm16 UTSW 4 154341552 missense probably benign 0.04
R8683:Prdm16 UTSW 4 154528704 missense probably damaging 1.00
RF008:Prdm16 UTSW 4 154341995 missense probably damaging 1.00
X0010:Prdm16 UTSW 4 154323377 missense probably damaging 1.00
Z1176:Prdm16 UTSW 4 154341786 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGGTGTCAAATGGCTACCC -3'
(R):5'- TTAGACAACCTGCCATCCTG -3'

Sequencing Primer
(F):5'- GCAGGTGACCCATGACCTTATTAG -3'
(R):5'- AACCTGCCATCCTGCCTGAC -3'
Posted On2015-10-08