Incidental Mutation 'R4627:Folh1'
ID348870
Institutional Source Beutler Lab
Gene Symbol Folh1
Ensembl Gene ENSMUSG00000001773
Gene Namefolate hydrolase 1
Synonymsprostate-specific membrane antigen, glutamate carboxypeptidase II, mopsm, GCP2
MMRRC Submission 041892-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4627 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86718977-86775943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86773252 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 59 (M59K)
Ref Sequence ENSEMBL: ENSMUSP00000001824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001824] [ENSMUST00000107271]
Predicted Effect probably benign
Transcript: ENSMUST00000001824
AA Change: M59K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000001824
Gene: ENSMUSG00000001773
AA Change: M59K

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PA 171 264 2.5e-16 PFAM
Pfam:Peptidase_M28 359 561 1.2e-18 PFAM
Pfam:TFR_dimer 629 749 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107271
AA Change: M59K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102892
Gene: ENSMUSG00000001773
AA Change: M59K

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PA 167 265 7e-18 PFAM
Pfam:Peptidase_M28 339 475 2.1e-15 PFAM
Pfam:TFR_dimer 595 718 1.1e-43 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in protection from peripheral neuropathy and ischemic brain injury. Homozygotes for a null allele show increased food intake, anxiety-like behavior, smaller sciatic nerve axons, and impaired angiogenesis. Homozygotes for a different null allele show less neuron degeneration and astrocyte damage after traumatic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Adam6a A T 12: 113,544,949 D314V probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Adamtsl2 T A 2: 27,093,585 L331Q probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Aldoart1 T C 4: 72,852,443 T43A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ano7 T C 1: 93,375,185 I15T probably benign Het
Aox3 A T 1: 58,125,035 T155S probably damaging Het
Ap2a1 C T 7: 44,904,419 V535M probably damaging Het
Apbb2 C T 5: 66,400,076 probably null Het
Astn1 C A 1: 158,502,251 H225Q possibly damaging Het
Atm A G 9: 53,456,506 I2439T possibly damaging Het
Atp1b2 T A 11: 69,601,334 I263F probably damaging Het
Ccdc184 A T 15: 98,168,757 N148Y probably benign Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Cep192 C G 18: 67,812,369 P180R probably benign Het
Cfap46 T C 7: 139,657,281 Y571C probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chchd6 G A 6: 89,384,660 L226F probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cobl T C 11: 12,251,093 E1214G probably damaging Het
Cpsf2 G A 12: 101,989,895 R319Q probably benign Het
Csdc2 T C 15: 81,949,123 V107A probably benign Het
Csmd1 A G 8: 16,697,917 W273R probably benign Het
Diexf T C 1: 193,107,695 T719A probably benign Het
Dnah2 T A 11: 69,465,376 N2156I probably damaging Het
Dsp A G 13: 38,168,641 Y165C probably benign Het
Exoc1 T C 5: 76,542,228 V205A probably benign Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fbln2 G T 6: 91,259,767 V755L probably damaging Het
Fhad1 A T 4: 141,896,468 V1371D possibly damaging Het
Foxf2 A T 13: 31,626,888 H270L probably benign Het
Gm14401 G A 2: 177,086,316 R65H probably benign Het
Gpn1 C A 5: 31,498,393 Y592* probably null Het
Hmcn1 T G 1: 150,595,894 D4903A probably benign Het
Hnf1a T C 5: 114,955,871 R220G probably damaging Het
Hoxd10 G A 2: 74,692,292 A105T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 C T 12: 25,057,042 T1498I possibly damaging Het
Klhl2 G T 8: 64,758,191 Y274* probably null Het
Lmbrd1 A G 1: 24,705,999 Y140C probably damaging Het
Mapk8ip3 G A 17: 24,903,293 T706I probably benign Het
Mast4 A C 13: 103,334,021 S58A possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mmachc A T 4: 116,703,471 S276T probably damaging Het
Nfat5 A T 8: 107,369,276 Q1289L probably damaging Het
Nlrc4 G T 17: 74,446,628 F253L probably damaging Het
Nr1i3 C A 1: 171,216,445 A112E probably benign Het
Olfr1367 T C 13: 21,347,464 F179L probably damaging Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr455 T A 6: 42,538,441 T194S possibly damaging Het
Olfr853 G T 9: 19,537,673 Q86K possibly damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pde10a A C 17: 8,981,652 D779A probably damaging Het
Pde4b T C 4: 102,601,605 L486S probably damaging Het
Pex2 A T 3: 5,561,281 I156N probably damaging Het
Phtf2 C T 5: 20,773,740 R63Q probably damaging Het
Prag1 A G 8: 36,103,292 Y343C probably damaging Het
Prdm16 A T 4: 154,367,240 Y170N probably damaging Het
Prpf6 A C 2: 181,601,474 K5T probably damaging Het
Ptpn1 A G 2: 167,967,781 K103R probably benign Het
Ralgapa2 A G 2: 146,361,453 S1159P possibly damaging Het
Rapgef3 G T 15: 97,758,929 D318E probably damaging Het
Ripk4 A T 16: 97,744,026 S474T probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Sec16a A G 2: 26,429,393 V1491A probably damaging Het
Sec16a C T 2: 26,431,068 probably null Het
Setd7 G T 3: 51,542,665 N113K probably damaging Het
Shank2 C T 7: 144,411,424 T1502M probably damaging Het
Skor1 A T 9: 63,145,476 C376S probably damaging Het
Slc12a3 A T 8: 94,329,384 L49F probably benign Het
Slc35d3 C T 10: 19,849,331 V260M probably damaging Het
Slc46a1 T A 11: 78,466,889 V256E probably benign Het
Slc6a1 T C 6: 114,308,106 S127P probably benign Het
Syngr4 A G 7: 45,887,028 L190P probably damaging Het
Tagap G A 17: 7,926,941 probably null Het
Tamm41 A T 6: 115,035,002 N89K probably benign Het
Tbc1d31 T A 15: 57,967,912 M922K probably benign Het
Tbk1 T C 10: 121,568,080 N254S possibly damaging Het
Tfec A G 6: 16,840,479 S140P probably damaging Het
Tnrc18 T C 5: 142,740,128 E1802G unknown Het
Tom1l2 C T 11: 60,242,707 probably null Het
Tonsl T G 15: 76,637,224 K323Q probably damaging Het
Tsnaxip1 A T 8: 105,841,407 E268D probably damaging Het
Ttf1 C A 2: 29,065,160 H179N possibly damaging Het
Ttn T C 2: 76,726,173 S30163G probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Ugt1a10 G A 1: 88,218,390 R519Q probably damaging Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vwa8 G A 14: 79,103,697 probably null Het
Zfp9 A G 6: 118,464,976 Y242H probably damaging Het
Other mutations in Folh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Folh1 APN 7 86734143 missense probably damaging 1.00
IGL00531:Folh1 APN 7 86719769 missense possibly damaging 0.82
IGL00772:Folh1 APN 7 86731784 missense probably damaging 1.00
IGL01339:Folh1 APN 7 86726098 missense probably damaging 1.00
IGL01373:Folh1 APN 7 86746142 missense probably benign 0.39
IGL01645:Folh1 APN 7 86742227 missense probably damaging 1.00
IGL01736:Folh1 APN 7 86742236 missense possibly damaging 0.96
IGL02104:Folh1 APN 7 86744430 missense possibly damaging 0.93
IGL02124:Folh1 APN 7 86725418 missense probably damaging 0.99
IGL02338:Folh1 APN 7 86736515 splice site probably benign
IGL02440:Folh1 APN 7 86734104 missense probably benign 0.09
IGL02689:Folh1 APN 7 86763045 splice site probably null
IGL02976:Folh1 APN 7 86762918 missense probably benign
IGL03022:Folh1 APN 7 86746171 missense possibly damaging 0.76
R0090:Folh1 UTSW 7 86725868 splice site probably benign
R0285:Folh1 UTSW 7 86742165 splice site probably benign
R0482:Folh1 UTSW 7 86746101 splice site probably benign
R0492:Folh1 UTSW 7 86746192 missense probably damaging 1.00
R1079:Folh1 UTSW 7 86771881 missense probably damaging 1.00
R1148:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1148:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1493:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1778:Folh1 UTSW 7 86761699 critical splice donor site probably null
R1865:Folh1 UTSW 7 86725906 missense possibly damaging 0.65
R1878:Folh1 UTSW 7 86771742 missense probably benign
R1906:Folh1 UTSW 7 86742166 splice site probably null
R1912:Folh1 UTSW 7 86762967 missense possibly damaging 0.95
R2263:Folh1 UTSW 7 86719765 missense probably benign
R3001:Folh1 UTSW 7 86723311 missense probably damaging 1.00
R3002:Folh1 UTSW 7 86723311 missense probably damaging 1.00
R3883:Folh1 UTSW 7 86775656 missense possibly damaging 0.48
R4061:Folh1 UTSW 7 86756962 missense possibly damaging 0.49
R4277:Folh1 UTSW 7 86762915 critical splice donor site probably null
R4507:Folh1 UTSW 7 86757008 missense probably benign
R4652:Folh1 UTSW 7 86744425 nonsense probably null
R4653:Folh1 UTSW 7 86744425 nonsense probably null
R4745:Folh1 UTSW 7 86723274 critical splice donor site probably null
R5571:Folh1 UTSW 7 86734120 missense probably damaging 1.00
R6000:Folh1 UTSW 7 86725934 missense probably benign 0.01
R6307:Folh1 UTSW 7 86723309 missense probably damaging 1.00
R6474:Folh1 UTSW 7 86775756 missense probably damaging 0.99
R7112:Folh1 UTSW 7 86775637 critical splice donor site probably null
R7131:Folh1 UTSW 7 86726112 missense probably damaging 1.00
R7449:Folh1 UTSW 7 86731748 missense probably benign 0.00
R7494:Folh1 UTSW 7 86719699 missense probably damaging 1.00
R7539:Folh1 UTSW 7 86725909 missense probably benign 0.35
R7764:Folh1 UTSW 7 86762918 missense probably benign
R7803:Folh1 UTSW 7 86726098 missense probably damaging 1.00
R8105:Folh1 UTSW 7 86746146 missense probably damaging 1.00
R8208:Folh1 UTSW 7 86725917 missense probably damaging 0.98
R8347:Folh1 UTSW 7 86729118 nonsense probably null
RF007:Folh1 UTSW 7 86775687 missense probably benign
Z1088:Folh1 UTSW 7 86725954 missense probably benign 0.00
Z1177:Folh1 UTSW 7 86744447 missense probably damaging 1.00
Z1177:Folh1 UTSW 7 86761822 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACAGGCAAAGACCAGCTT -3'
(R):5'- ACATGAGAAGCACAGATCATATAAGA -3'

Sequencing Primer
(F):5'- TGGCTTGCAACAACTGGTC -3'
(R):5'- ATCCTGACATGAGCTCG -3'
Posted On2015-10-08