Mutagenetix > Incidental Mutations

Incidental Mutation 'R4627:Shank2'

348875

Institutional Source

Beutler Lab

Gene Symbol

Shank2

Ensembl Gene

ENSMUSG00000037541

Gene Name

SH3 and multiple ankyrin repeat domains 2

Synonyms

ProSAP1

MMRRC Submission

041892-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4627 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

144001928-144424494 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 144411424 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 1502 (T1502M)

Ref Sequence

ENSEMBL: ENSMUSP00000101522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097929] [ENSMUST00000105900] [ENSMUST00000105902] [ENSMUST00000146006]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000097929
AA Change: T916M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095542
Gene: ENSMUSG00000037541
AA Change: T916M

Domain	Start	End	E-Value	Type
PDZ	46	131	1.75e-14	SMART
low complexity region	135	154	N/A	INTRINSIC
low complexity region	299	314	N/A	INTRINSIC
low complexity region	452	464	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	570	582	N/A	INTRINSIC
low complexity region	619	637	N/A	INTRINSIC
low complexity region	814	828	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	915	937	N/A	INTRINSIC
low complexity region	951	967	N/A	INTRINSIC
low complexity region	989	997	N/A	INTRINSIC
low complexity region	1077	1091	N/A	INTRINSIC
low complexity region	1134	1149	N/A	INTRINSIC
low complexity region	1173	1187	N/A	INTRINSIC
SAM	1196	1262	2.52e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105900
AA Change: T1133M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101520
Gene: ENSMUSG00000037541
AA Change: T1133M

Domain	Start	End	E-Value	Type
SH3	150	205	1.04e-14	SMART
PDZ	256	341	1.75e-14	SMART
low complexity region	345	364	N/A	INTRINSIC
low complexity region	509	524	N/A	INTRINSIC
low complexity region	662	674	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	780	792	N/A	INTRINSIC
low complexity region	829	847	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1093	1104	N/A	INTRINSIC
low complexity region	1125	1147	N/A	INTRINSIC
low complexity region	1161	1177	N/A	INTRINSIC
low complexity region	1199	1207	N/A	INTRINSIC
low complexity region	1287	1301	N/A	INTRINSIC
low complexity region	1344	1359	N/A	INTRINSIC
low complexity region	1383	1397	N/A	INTRINSIC
SAM	1406	1472	2.52e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105902
AA Change: T1502M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: T1502M

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:FERM_f0	57	140	1.4e-21	PFAM
ANK	196	226	1.4e1	SMART
ANK	230	259	2.77e-3	SMART
ANK	263	293	1.42e0	SMART
ANK	297	326	1.25e-1	SMART
ANK	330	359	7.83e-3	SMART
ANK	363	391	1.29e2	SMART
SH3	529	584	1.04e-14	SMART
PDZ	635	720	1.75e-14	SMART
low complexity region	724	743	N/A	INTRINSIC
low complexity region	878	893	N/A	INTRINSIC
low complexity region	1031	1043	N/A	INTRINSIC
low complexity region	1118	1129	N/A	INTRINSIC
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1462	1473	N/A	INTRINSIC
low complexity region	1494	1516	N/A	INTRINSIC
low complexity region	1530	1546	N/A	INTRINSIC
low complexity region	1568	1576	N/A	INTRINSIC
low complexity region	1656	1670	N/A	INTRINSIC
low complexity region	1713	1728	N/A	INTRINSIC
low complexity region	1752	1766	N/A	INTRINSIC
SAM	1775	1841	2.52e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125355

Predicted Effect

probably benign
Transcript: ENSMUST00000146006
AA Change: T923M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,068,092	S393P	probably benign	Het
Adam6a	A	T	12: 113,544,949	D314V	probably benign	Het
Adamts18	C	T	8: 113,773,168	W371*	probably null	Het
Adamtsl2	T	A	2: 27,093,585	L331Q	probably damaging	Het
Akr1c13	G	T	13: 4,197,870	V214F	probably damaging	Het
Aldoart1	T	C	4: 72,852,443	T43A	probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ano7	T	C	1: 93,375,185	I15T	probably benign	Het
Aox3	A	T	1: 58,125,035	T155S	probably damaging	Het
Ap2a1	C	T	7: 44,904,419	V535M	probably damaging	Het
Apbb2	C	T	5: 66,400,076		probably null	Het
Astn1	C	A	1: 158,502,251	H225Q	possibly damaging	Het
Atm	A	G	9: 53,456,506	I2439T	possibly damaging	Het
Atp1b2	T	A	11: 69,601,334	I263F	probably damaging	Het
Ccdc184	A	T	15: 98,168,757	N148Y	probably benign	Het
Cdca7	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	2: 72,481,861		probably benign	Het
Cep192	C	G	18: 67,812,369	P180R	probably benign	Het
Cfap46	T	C	7: 139,657,281	Y571C	probably damaging	Het
Cfap46	A	T	7: 139,680,927	L85Q	probably damaging	Het
Chchd6	G	A	6: 89,384,660	L226F	probably damaging	Het
Cnot6l	A	G	5: 96,077,211	V541A	probably benign	Het
Cobl	T	C	11: 12,251,093	E1214G	probably damaging	Het
Cpsf2	G	A	12: 101,989,895	R319Q	probably benign	Het
Csdc2	T	C	15: 81,949,123	V107A	probably benign	Het
Csmd1	A	G	8: 16,697,917	W273R	probably benign	Het
Diexf	T	C	1: 193,107,695	T719A	probably benign	Het
Dnah2	T	A	11: 69,465,376	N2156I	probably damaging	Het
Dsp	A	G	13: 38,168,641	Y165C	probably benign	Het
Exoc1	T	C	5: 76,542,228	V205A	probably benign	Het
Fam98c	T	C	7: 29,155,268	T49A	possibly damaging	Het
Fbln2	G	T	6: 91,259,767	V755L	probably damaging	Het
Fhad1	A	T	4: 141,896,468	V1371D	possibly damaging	Het
Folh1	A	T	7: 86,773,252	M59K	probably benign	Het
Foxf2	A	T	13: 31,626,888	H270L	probably benign	Het
Gm14401	G	A	2: 177,086,316	R65H	probably benign	Het
Gpn1	C	A	5: 31,498,393	Y592*	probably null	Het
Hmcn1	T	G	1: 150,595,894	D4903A	probably benign	Het
Hnf1a	T	C	5: 114,955,871	R220G	probably damaging	Het
Hoxd10	G	A	2: 74,692,292	A105T	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kidins220	C	T	12: 25,057,042	T1498I	possibly damaging	Het
Klhl2	G	T	8: 64,758,191	Y274*	probably null	Het
Lmbrd1	A	G	1: 24,705,999	Y140C	probably damaging	Het
Mapk8ip3	G	A	17: 24,903,293	T706I	probably benign	Het
Mast4	A	C	13: 103,334,021	S58A	possibly damaging	Het
Mcm6	T	C	1: 128,351,548	D167G	probably benign	Het
Mmachc	A	T	4: 116,703,471	S276T	probably damaging	Het
Nfat5	A	T	8: 107,369,276	Q1289L	probably damaging	Het
Nlrc4	G	T	17: 74,446,628	F253L	probably damaging	Het
Nr1i3	C	A	1: 171,216,445	A112E	probably benign	Het
Olfr1367	T	C	13: 21,347,464	F179L	probably damaging	Het
Olfr45	T	A	7: 140,691,378	S158T	probably benign	Het
Olfr455	T	A	6: 42,538,441	T194S	possibly damaging	Het
Olfr853	G	T	9: 19,537,673	Q86K	possibly damaging	Het
Orc5	G	T	5: 22,548,005	F10L	probably benign	Het
Pde10a	A	C	17: 8,981,652	D779A	probably damaging	Het
Pde4b	T	C	4: 102,601,605	L486S	probably damaging	Het
Pex2	A	T	3: 5,561,281	I156N	probably damaging	Het
Phtf2	C	T	5: 20,773,740	R63Q	probably damaging	Het
Prag1	A	G	8: 36,103,292	Y343C	probably damaging	Het
Prdm16	A	T	4: 154,367,240	Y170N	probably damaging	Het
Prpf6	A	C	2: 181,601,474	K5T	probably damaging	Het
Ptpn1	A	G	2: 167,967,781	K103R	probably benign	Het
Ralgapa2	A	G	2: 146,361,453	S1159P	possibly damaging	Het
Rapgef3	G	T	15: 97,758,929	D318E	probably damaging	Het
Ripk4	A	T	16: 97,744,026	S474T	probably damaging	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Sec16a	A	G	2: 26,429,393	V1491A	probably damaging	Het
Sec16a	C	T	2: 26,431,068		probably null	Het
Setd7	G	T	3: 51,542,665	N113K	probably damaging	Het
Skor1	A	T	9: 63,145,476	C376S	probably damaging	Het
Slc12a3	A	T	8: 94,329,384	L49F	probably benign	Het
Slc35d3	C	T	10: 19,849,331	V260M	probably damaging	Het
Slc46a1	T	A	11: 78,466,889	V256E	probably benign	Het
Slc6a1	T	C	6: 114,308,106	S127P	probably benign	Het
Syngr4	A	G	7: 45,887,028	L190P	probably damaging	Het
Tagap	G	A	17: 7,926,941		probably null	Het
Tamm41	A	T	6: 115,035,002	N89K	probably benign	Het
Tbc1d31	T	A	15: 57,967,912	M922K	probably benign	Het
Tbk1	T	C	10: 121,568,080	N254S	possibly damaging	Het
Tfec	A	G	6: 16,840,479	S140P	probably damaging	Het
Tnrc18	T	C	5: 142,740,128	E1802G	unknown	Het
Tom1l2	C	T	11: 60,242,707		probably null	Het
Tonsl	T	G	15: 76,637,224	K323Q	probably damaging	Het
Tsnaxip1	A	T	8: 105,841,407	E268D	probably damaging	Het
Ttf1	C	A	2: 29,065,160	H179N	possibly damaging	Het
Ttn	T	C	2: 76,726,173	S30163G	probably damaging	Het
Ube2c	A	G	2: 164,772,173	N143S	possibly damaging	Het
Ugt1a10	G	A	1: 88,218,390	R519Q	probably damaging	Het
Vmn2r9	T	C	5: 108,847,597	Y395C	probably damaging	Het
Vwa8	G	A	14: 79,103,697		probably null	Het
Zfp9	A	G	6: 118,464,976	Y242H	probably damaging	Het

Other mutations in Shank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Shank2	APN	7	144411847	missense	probably damaging	1.00
IGL00516:Shank2	APN	7	144410775	missense	possibly damaging	0.96
IGL00919:Shank2	APN	7	144411271	missense	probably damaging	0.97
IGL01450:Shank2	APN	7	144285068	nonsense	probably null
IGL01996:Shank2	APN	7	144411493	missense	probably damaging	1.00
IGL02217:Shank2	APN	7	144285047	missense	possibly damaging	0.59
IGL02314:Shank2	APN	7	144411271	missense	probably benign	0.01
IGL02320:Shank2	APN	7	144420944	missense	probably damaging	1.00
IGL02948:Shank2	APN	7	144409636	missense	probably benign	0.03
IGL02997:Shank2	APN	7	144081873	missense	probably benign	0.16
R0077:Shank2	UTSW	7	144192467	missense	possibly damaging	0.85
R0109:Shank2	UTSW	7	144410577	missense	possibly damaging	0.81
R0126:Shank2	UTSW	7	144031355	missense	probably damaging	0.99
R0153:Shank2	UTSW	7	144070135	missense	probably benign	0.04
R0644:Shank2	UTSW	7	144411849	missense	probably benign
R1072:Shank2	UTSW	7	144411568	missense	probably damaging	1.00
R1245:Shank2	UTSW	7	144411720	missense	probably benign	0.00
R1424:Shank2	UTSW	7	144052372	missense	probably damaging	0.99
R1712:Shank2	UTSW	7	144411153	missense	probably damaging	1.00
R1739:Shank2	UTSW	7	144179853	missense	probably damaging	1.00
R1791:Shank2	UTSW	7	144410599	missense	probably damaging	1.00
R1889:Shank2	UTSW	7	144186858	nonsense	probably null
R2074:Shank2	UTSW	7	144409540	missense	probably damaging	1.00
R2135:Shank2	UTSW	7	144411234	missense	probably damaging	0.99
R2355:Shank2	UTSW	7	144057718	missense	possibly damaging	0.94
R2511:Shank2	UTSW	7	144411577	missense	probably damaging	1.00
R2517:Shank2	UTSW	7	144052305	missense	possibly damaging	0.89
R2570:Shank2	UTSW	7	144068770	missense	probably damaging	1.00
R2846:Shank2	UTSW	7	144070055	missense	probably damaging	1.00
R3159:Shank2	UTSW	7	144081874	missense	probably damaging	0.98
R3881:Shank2	UTSW	7	144405384	missense	probably benign
R3907:Shank2	UTSW	7	144409576	missense	probably damaging	1.00
R3938:Shank2	UTSW	7	144128375	missense	probably benign	0.20
R4151:Shank2	UTSW	7	144054828	missense	probably damaging	1.00
R4369:Shank2	UTSW	7	144179781	missense	probably damaging	0.99
R4372:Shank2	UTSW	7	144410862	missense	probably benign	0.09
R4519:Shank2	UTSW	7	144410205	missense	probably damaging	1.00
R4645:Shank2	UTSW	7	144410422	missense	possibly damaging	0.65
R4647:Shank2	UTSW	7	144411829	missense	probably damaging	1.00
R4689:Shank2	UTSW	7	144420605	missense	probably benign	0.07
R4751:Shank2	UTSW	7	144409468	missense	probably damaging	1.00
R4816:Shank2	UTSW	7	144052306	missense	probably damaging	1.00
R4843:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R4929:Shank2	UTSW	7	144411271	missense	probably benign	0.01
R5009:Shank2	UTSW	7	144070179	missense	probably benign	0.00
R5027:Shank2	UTSW	7	144259105	nonsense	probably null
R5165:Shank2	UTSW	7	144409636	missense	possibly damaging	0.62
R5278:Shank2	UTSW	7	144068875	critical splice donor site	probably null
R5332:Shank2	UTSW	7	144411292	missense	possibly damaging	0.82
R5497:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R5525:Shank2	UTSW	7	144070109	missense	probably damaging	1.00
R5575:Shank2	UTSW	7	144410134	missense	probably damaging	1.00
R5948:Shank2	UTSW	7	144407223	missense	probably damaging	0.98
R6024:Shank2	UTSW	7	144180031	missense	probably benign	0.12
R6306:Shank2	UTSW	7	144409680	missense	probably benign	0.00
R6317:Shank2	UTSW	7	144285084	missense	possibly damaging	0.89
R6358:Shank2	UTSW	7	144031297	missense	probably benign	0.25
R6364:Shank2	UTSW	7	144410409	missense	probably benign	0.14
R6413:Shank2	UTSW	7	144410218	missense	probably damaging	1.00
R6680:Shank2	UTSW	7	144420866	missense	probably damaging	1.00
R6834:Shank2	UTSW	7	144409894	missense	probably damaging	1.00
R6870:Shank2	UTSW	7	144052460	missense	probably damaging	0.99
R6933:Shank2	UTSW	7	144091778	missense	probably benign	0.19
R6983:Shank2	UTSW	7	144081848	missense	possibly damaging	0.94
R7082:Shank2	UTSW	7	144410359	missense	probably damaging	0.99
R7100:Shank2	UTSW	7	144411164	missense	possibly damaging	0.73
R7111:Shank2	UTSW	7	144411552	missense	probably benign	0.00
R7213:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R7225:Shank2	UTSW	7	144285025	missense	probably benign	0.42
R7325:Shank2	UTSW	7	144411685	missense	probably benign	0.04
R7605:Shank2	UTSW	7	144091779	missense	possibly damaging	0.64
R7909:Shank2	UTSW	7	144411394	missense	probably damaging	1.00
R7976:Shank2	UTSW	7	144411061	missense	probably damaging	0.99
R8118:Shank2	UTSW	7	144409875	missense	probably benign	0.01
R8722:Shank2	UTSW	7	144175748	intron	probably benign
R8866:Shank2	UTSW	7	144411249	missense	probably benign
R8919:Shank2	UTSW	7	144411528	missense	probably damaging	1.00
R8944:Shank2	UTSW	7	144070190	missense	probably damaging	1.00
R9033:Shank2	UTSW	7	144411499	missense	probably damaging	0.99
R9091:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9252:Shank2	UTSW	7	144068798	missense	possibly damaging	0.96
R9270:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9350:Shank2	UTSW	7	144407208	missense	probably benign	0.00
R9362:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R9471:Shank2	UTSW	7	144411015	missense	possibly damaging	0.77
RF009:Shank2	UTSW	7	144411571	missense	possibly damaging	0.81
Z1176:Shank2	UTSW	7	144128377	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGACCTGGTCAAGCAGAAG -3'
(R):5'- ATCACAAAGCCATCCGTGTC -3'

Sequencing Primer
(F):5'- GCCCCCTACGTTGAACTCCAG -3'
(R):5'- ATCCGTGTCCTCTTCTGGGAG -3'

Posted On

2015-10-08