Mutagenetix > Incidental Mutations

Incidental Mutation 'R4627:Adamts18'

348881

Institutional Source

Beutler Lab

Gene Symbol

Adamts18

Ensembl Gene

ENSMUSG00000053399

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18

Synonyms

E130314N14Rik

MMRRC Submission

041892-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R4627 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113697126-113848738 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 113773168 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 371 (W371*)

Ref Sequence

ENSEMBL: ENSMUSP00000090801 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]

AlphaFold

Q4VC17

Predicted Effect

probably null
Transcript: ENSMUST00000093113
AA Change: W371*

SMART Domains

Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: W371*

Domain	Start	End	E-Value	Type
signal peptide	1	47	N/A	INTRINSIC
Pfam:Pep_M12B_propep	63	203	3.4e-37	PFAM
Pfam:Reprolysin_5	292	473	1.3e-14	PFAM
Pfam:Reprolysin_4	294	494	2.6e-11	PFAM
Pfam:Reprolysin	294	498	2.7e-30	PFAM
Pfam:Reprolysin_2	311	488	1.7e-14	PFAM
Pfam:Reprolysin_3	315	447	1.5e-11	PFAM
TSP1	592	644	7.37e-17	SMART
Pfam:ADAM_spacer1	749	861	1.7e-38	PFAM
TSP1	878	932	1.55e-1	SMART
TSP1	934	992	5.07e-6	SMART
TSP1	994	1049	1.65e-5	SMART
TSP1	1055	1116	1.71e-3	SMART
TSP1	1125	1171	5.27e-4	SMART
Pfam:PLAC	1186	1216	1.2e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212437

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212527

Predicted Effect

probably benign
Transcript: ENSMUST00000212665

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213061

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213076

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213078

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,068,092	S393P	probably benign	Het
Adam6a	A	T	12: 113,544,949	D314V	probably benign	Het
Adamtsl2	T	A	2: 27,093,585	L331Q	probably damaging	Het
Akr1c13	G	T	13: 4,197,870	V214F	probably damaging	Het
Aldoart1	T	C	4: 72,852,443	T43A	probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ano7	T	C	1: 93,375,185	I15T	probably benign	Het
Aox3	A	T	1: 58,125,035	T155S	probably damaging	Het
Ap2a1	C	T	7: 44,904,419	V535M	probably damaging	Het
Apbb2	C	T	5: 66,400,076		probably null	Het
Astn1	C	A	1: 158,502,251	H225Q	possibly damaging	Het
Atm	A	G	9: 53,456,506	I2439T	possibly damaging	Het
Atp1b2	T	A	11: 69,601,334	I263F	probably damaging	Het
Ccdc184	A	T	15: 98,168,757	N148Y	probably benign	Het
Cdca7	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	2: 72,481,861		probably benign	Het
Cep192	C	G	18: 67,812,369	P180R	probably benign	Het
Cfap46	T	C	7: 139,657,281	Y571C	probably damaging	Het
Cfap46	A	T	7: 139,680,927	L85Q	probably damaging	Het
Chchd6	G	A	6: 89,384,660	L226F	probably damaging	Het
Cnot6l	A	G	5: 96,077,211	V541A	probably benign	Het
Cobl	T	C	11: 12,251,093	E1214G	probably damaging	Het
Cpsf2	G	A	12: 101,989,895	R319Q	probably benign	Het
Csdc2	T	C	15: 81,949,123	V107A	probably benign	Het
Csmd1	A	G	8: 16,697,917	W273R	probably benign	Het
Diexf	T	C	1: 193,107,695	T719A	probably benign	Het
Dnah2	T	A	11: 69,465,376	N2156I	probably damaging	Het
Dsp	A	G	13: 38,168,641	Y165C	probably benign	Het
Exoc1	T	C	5: 76,542,228	V205A	probably benign	Het
Fam98c	T	C	7: 29,155,268	T49A	possibly damaging	Het
Fbln2	G	T	6: 91,259,767	V755L	probably damaging	Het
Fhad1	A	T	4: 141,896,468	V1371D	possibly damaging	Het
Folh1	A	T	7: 86,773,252	M59K	probably benign	Het
Foxf2	A	T	13: 31,626,888	H270L	probably benign	Het
Gm14401	G	A	2: 177,086,316	R65H	probably benign	Het
Gpn1	C	A	5: 31,498,393	Y592*	probably null	Het
Hmcn1	T	G	1: 150,595,894	D4903A	probably benign	Het
Hnf1a	T	C	5: 114,955,871	R220G	probably damaging	Het
Hoxd10	G	A	2: 74,692,292	A105T	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kidins220	C	T	12: 25,057,042	T1498I	possibly damaging	Het
Klhl2	G	T	8: 64,758,191	Y274*	probably null	Het
Lmbrd1	A	G	1: 24,705,999	Y140C	probably damaging	Het
Mapk8ip3	G	A	17: 24,903,293	T706I	probably benign	Het
Mast4	A	C	13: 103,334,021	S58A	possibly damaging	Het
Mcm6	T	C	1: 128,351,548	D167G	probably benign	Het
Mmachc	A	T	4: 116,703,471	S276T	probably damaging	Het
Nfat5	A	T	8: 107,369,276	Q1289L	probably damaging	Het
Nlrc4	G	T	17: 74,446,628	F253L	probably damaging	Het
Nr1i3	C	A	1: 171,216,445	A112E	probably benign	Het
Olfr1367	T	C	13: 21,347,464	F179L	probably damaging	Het
Olfr45	T	A	7: 140,691,378	S158T	probably benign	Het
Olfr455	T	A	6: 42,538,441	T194S	possibly damaging	Het
Olfr853	G	T	9: 19,537,673	Q86K	possibly damaging	Het
Orc5	G	T	5: 22,548,005	F10L	probably benign	Het
Pde10a	A	C	17: 8,981,652	D779A	probably damaging	Het
Pde4b	T	C	4: 102,601,605	L486S	probably damaging	Het
Pex2	A	T	3: 5,561,281	I156N	probably damaging	Het
Phtf2	C	T	5: 20,773,740	R63Q	probably damaging	Het
Prag1	A	G	8: 36,103,292	Y343C	probably damaging	Het
Prdm16	A	T	4: 154,367,240	Y170N	probably damaging	Het
Prpf6	A	C	2: 181,601,474	K5T	probably damaging	Het
Ptpn1	A	G	2: 167,967,781	K103R	probably benign	Het
Ralgapa2	A	G	2: 146,361,453	S1159P	possibly damaging	Het
Rapgef3	G	T	15: 97,758,929	D318E	probably damaging	Het
Ripk4	A	T	16: 97,744,026	S474T	probably damaging	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Sec16a	A	G	2: 26,429,393	V1491A	probably damaging	Het
Sec16a	C	T	2: 26,431,068		probably null	Het
Setd7	G	T	3: 51,542,665	N113K	probably damaging	Het
Shank2	C	T	7: 144,411,424	T1502M	probably damaging	Het
Skor1	A	T	9: 63,145,476	C376S	probably damaging	Het
Slc12a3	A	T	8: 94,329,384	L49F	probably benign	Het
Slc35d3	C	T	10: 19,849,331	V260M	probably damaging	Het
Slc46a1	T	A	11: 78,466,889	V256E	probably benign	Het
Slc6a1	T	C	6: 114,308,106	S127P	probably benign	Het
Syngr4	A	G	7: 45,887,028	L190P	probably damaging	Het
Tagap	G	A	17: 7,926,941		probably null	Het
Tamm41	A	T	6: 115,035,002	N89K	probably benign	Het
Tbc1d31	T	A	15: 57,967,912	M922K	probably benign	Het
Tbk1	T	C	10: 121,568,080	N254S	possibly damaging	Het
Tfec	A	G	6: 16,840,479	S140P	probably damaging	Het
Tnrc18	T	C	5: 142,740,128	E1802G	unknown	Het
Tom1l2	C	T	11: 60,242,707		probably null	Het
Tonsl	T	G	15: 76,637,224	K323Q	probably damaging	Het
Tsnaxip1	A	T	8: 105,841,407	E268D	probably damaging	Het
Ttf1	C	A	2: 29,065,160	H179N	possibly damaging	Het
Ttn	T	C	2: 76,726,173	S30163G	probably damaging	Het
Ube2c	A	G	2: 164,772,173	N143S	possibly damaging	Het
Ugt1a10	G	A	1: 88,218,390	R519Q	probably damaging	Het
Vmn2r9	T	C	5: 108,847,597	Y395C	probably damaging	Het
Vwa8	G	A	14: 79,103,697		probably null	Het
Zfp9	A	G	6: 118,464,976	Y242H	probably damaging	Het

Other mutations in Adamts18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01290:Adamts18	APN	8	113774943	missense	probably damaging	1.00
IGL01548:Adamts18	APN	8	113764299	missense	probably damaging	1.00
IGL01556:Adamts18	APN	8	113845109	missense	probably benign	0.01
IGL01833:Adamts18	APN	8	113743096	missense	probably benign	0.10
IGL02187:Adamts18	APN	8	113713194	missense	possibly damaging	0.93
IGL02551:Adamts18	APN	8	113699072	missense	probably damaging	1.00
IGL02756:Adamts18	APN	8	113714344	splice site	probably benign
IGL03188:Adamts18	APN	8	113699024	missense	probably damaging	1.00
IGL03411:Adamts18	APN	8	113764297	nonsense	probably null
G1patch:Adamts18	UTSW	8	113743201	missense	probably damaging	1.00
R0119:Adamts18	UTSW	8	113774953	missense	possibly damaging	0.94
R0378:Adamts18	UTSW	8	113743117	missense	probably damaging	1.00
R0410:Adamts18	UTSW	8	113714358	nonsense	probably null
R0480:Adamts18	UTSW	8	113738818	missense	possibly damaging	0.93
R0514:Adamts18	UTSW	8	113738769	splice site	probably null
R0924:Adamts18	UTSW	8	113705396	splice site	probably null
R0930:Adamts18	UTSW	8	113705396	splice site	probably null
R1333:Adamts18	UTSW	8	113705173	splice site	probably benign
R1441:Adamts18	UTSW	8	113754562	critical splice donor site	probably null
R2082:Adamts18	UTSW	8	113775333	missense	probably damaging	1.00
R2146:Adamts18	UTSW	8	113845003	missense	possibly damaging	0.58
R2371:Adamts18	UTSW	8	113705261	missense	probably benign	0.36
R3148:Adamts18	UTSW	8	113738858	missense	probably damaging	1.00
R3963:Adamts18	UTSW	8	113777811	missense	probably benign	0.00
R4056:Adamts18	UTSW	8	113737580	nonsense	probably null
R4486:Adamts18	UTSW	8	113713193	missense	probably benign	0.00
R4608:Adamts18	UTSW	8	113737613	missense	probably damaging	1.00
R4624:Adamts18	UTSW	8	113773168	nonsense	probably null
R4626:Adamts18	UTSW	8	113773168	nonsense	probably null
R4628:Adamts18	UTSW	8	113773168	nonsense	probably null
R4629:Adamts18	UTSW	8	113773168	nonsense	probably null
R4710:Adamts18	UTSW	8	113706926	missense	probably damaging	0.98
R4959:Adamts18	UTSW	8	113736725	nonsense	probably null
R4973:Adamts18	UTSW	8	113736725	nonsense	probably null
R4976:Adamts18	UTSW	8	113699010	missense	probably benign	0.31
R5119:Adamts18	UTSW	8	113699010	missense	probably benign	0.31
R5141:Adamts18	UTSW	8	113775270	missense	probably damaging	1.00
R5422:Adamts18	UTSW	8	113698974	missense	probably benign	0.06
R5587:Adamts18	UTSW	8	113775360	nonsense	probably null
R5868:Adamts18	UTSW	8	113777748	missense	possibly damaging	0.69
R5893:Adamts18	UTSW	8	113773077	missense	probably damaging	1.00
R5906:Adamts18	UTSW	8	113709619	missense	probably benign	0.00
R5942:Adamts18	UTSW	8	113777748	missense	probably benign	0.01
R6006:Adamts18	UTSW	8	113706974	missense	probably damaging	1.00
R6608:Adamts18	UTSW	8	113775279	missense	probably damaging	1.00
R6725:Adamts18	UTSW	8	113743201	missense	probably damaging	1.00
R7002:Adamts18	UTSW	8	113775290	missense	possibly damaging	0.69
R7276:Adamts18	UTSW	8	113775264	missense	probably damaging	0.99
R7292:Adamts18	UTSW	8	113709645	missense	probably benign	0.00
R7411:Adamts18	UTSW	8	113777730	missense	probably damaging	0.99
R7685:Adamts18	UTSW	8	113713223	missense	probably damaging	1.00
R7737:Adamts18	UTSW	8	113736934	splice site	probably null
R7860:Adamts18	UTSW	8	113775276	missense	probably damaging	1.00
R7936:Adamts18	UTSW	8	113767128	missense	probably damaging	1.00
R8197:Adamts18	UTSW	8	113754595	missense	probably damaging	1.00
R8363:Adamts18	UTSW	8	113767163	missense	probably damaging	1.00
R8759:Adamts18	UTSW	8	113706992	missense	probably damaging	1.00
R8934:Adamts18	UTSW	8	113736878	missense	possibly damaging	0.90
R9405:Adamts18	UTSW	8	113703398	missense	probably damaging	1.00
R9422:Adamts18	UTSW	8	113775278	missense	probably damaging	1.00
R9450:Adamts18	UTSW	8	113764310	missense	probably benign	0.10
R9475:Adamts18	UTSW	8	113777938	missense	possibly damaging	0.93
Z1088:Adamts18	UTSW	8	113775440	missense	possibly damaging	0.86
Z1176:Adamts18	UTSW	8	113743168	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- ATGAGACTCAAAAGGGCCAC -3'
(R):5'- TTGGTGCAGCTTAGCTCAG -3'

Sequencing Primer
(F):5'- CACATCCATCGGAAAGTTGTC -3'
(R):5'- TTTTTCCTACTGATAATTTCTCCGAG -3'

Posted On

2015-10-08