Incidental Mutation 'R4627:Atm'
ID348883
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Nameataxia telangiectasia mutated
SynonymsC030026E19Rik
MMRRC Submission 041892-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R4627 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location53439149-53536740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53456506 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 2439 (I2439T)
Ref Sequence ENSEMBL: ENSMUSP00000113388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
Predicted Effect possibly damaging
Transcript: ENSMUST00000118282
AA Change: I2439T

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: I2439T

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132249
SMART Domains Protein: ENSMUSP00000118199
Gene: ENSMUSG00000034218

DomainStartEndE-ValueType
PI3Kc 68 201 5.38e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000232179
AA Change: I2442T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Adam6a A T 12: 113,544,949 D314V probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Adamtsl2 T A 2: 27,093,585 L331Q probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Aldoart1 T C 4: 72,852,443 T43A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ano7 T C 1: 93,375,185 I15T probably benign Het
Aox3 A T 1: 58,125,035 T155S probably damaging Het
Ap2a1 C T 7: 44,904,419 V535M probably damaging Het
Apbb2 C T 5: 66,400,076 probably null Het
Astn1 C A 1: 158,502,251 H225Q possibly damaging Het
Atp1b2 T A 11: 69,601,334 I263F probably damaging Het
Ccdc184 A T 15: 98,168,757 N148Y probably benign Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Cep192 C G 18: 67,812,369 P180R probably benign Het
Cfap46 T C 7: 139,657,281 Y571C probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chchd6 G A 6: 89,384,660 L226F probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cobl T C 11: 12,251,093 E1214G probably damaging Het
Cpsf2 G A 12: 101,989,895 R319Q probably benign Het
Csdc2 T C 15: 81,949,123 V107A probably benign Het
Csmd1 A G 8: 16,697,917 W273R probably benign Het
Diexf T C 1: 193,107,695 T719A probably benign Het
Dnah2 T A 11: 69,465,376 N2156I probably damaging Het
Dsp A G 13: 38,168,641 Y165C probably benign Het
Exoc1 T C 5: 76,542,228 V205A probably benign Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fbln2 G T 6: 91,259,767 V755L probably damaging Het
Fhad1 A T 4: 141,896,468 V1371D possibly damaging Het
Folh1 A T 7: 86,773,252 M59K probably benign Het
Foxf2 A T 13: 31,626,888 H270L probably benign Het
Gm14401 G A 2: 177,086,316 R65H probably benign Het
Gpn1 C A 5: 31,498,393 Y592* probably null Het
Hmcn1 T G 1: 150,595,894 D4903A probably benign Het
Hnf1a T C 5: 114,955,871 R220G probably damaging Het
Hoxd10 G A 2: 74,692,292 A105T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 C T 12: 25,057,042 T1498I possibly damaging Het
Klhl2 G T 8: 64,758,191 Y274* probably null Het
Lmbrd1 A G 1: 24,705,999 Y140C probably damaging Het
Mapk8ip3 G A 17: 24,903,293 T706I probably benign Het
Mast4 A C 13: 103,334,021 S58A possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mmachc A T 4: 116,703,471 S276T probably damaging Het
Nfat5 A T 8: 107,369,276 Q1289L probably damaging Het
Nlrc4 G T 17: 74,446,628 F253L probably damaging Het
Nr1i3 C A 1: 171,216,445 A112E probably benign Het
Olfr1367 T C 13: 21,347,464 F179L probably damaging Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr455 T A 6: 42,538,441 T194S possibly damaging Het
Olfr853 G T 9: 19,537,673 Q86K possibly damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pde10a A C 17: 8,981,652 D779A probably damaging Het
Pde4b T C 4: 102,601,605 L486S probably damaging Het
Pex2 A T 3: 5,561,281 I156N probably damaging Het
Phtf2 C T 5: 20,773,740 R63Q probably damaging Het
Prag1 A G 8: 36,103,292 Y343C probably damaging Het
Prdm16 A T 4: 154,367,240 Y170N probably damaging Het
Prpf6 A C 2: 181,601,474 K5T probably damaging Het
Ptpn1 A G 2: 167,967,781 K103R probably benign Het
Ralgapa2 A G 2: 146,361,453 S1159P possibly damaging Het
Rapgef3 G T 15: 97,758,929 D318E probably damaging Het
Ripk4 A T 16: 97,744,026 S474T probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Sec16a A G 2: 26,429,393 V1491A probably damaging Het
Sec16a C T 2: 26,431,068 probably null Het
Setd7 G T 3: 51,542,665 N113K probably damaging Het
Shank2 C T 7: 144,411,424 T1502M probably damaging Het
Skor1 A T 9: 63,145,476 C376S probably damaging Het
Slc12a3 A T 8: 94,329,384 L49F probably benign Het
Slc35d3 C T 10: 19,849,331 V260M probably damaging Het
Slc46a1 T A 11: 78,466,889 V256E probably benign Het
Slc6a1 T C 6: 114,308,106 S127P probably benign Het
Syngr4 A G 7: 45,887,028 L190P probably damaging Het
Tagap G A 17: 7,926,941 probably null Het
Tamm41 A T 6: 115,035,002 N89K probably benign Het
Tbc1d31 T A 15: 57,967,912 M922K probably benign Het
Tbk1 T C 10: 121,568,080 N254S possibly damaging Het
Tfec A G 6: 16,840,479 S140P probably damaging Het
Tnrc18 T C 5: 142,740,128 E1802G unknown Het
Tom1l2 C T 11: 60,242,707 probably null Het
Tonsl T G 15: 76,637,224 K323Q probably damaging Het
Tsnaxip1 A T 8: 105,841,407 E268D probably damaging Het
Ttf1 C A 2: 29,065,160 H179N possibly damaging Het
Ttn T C 2: 76,726,173 S30163G probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Ugt1a10 G A 1: 88,218,390 R519Q probably damaging Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vwa8 G A 14: 79,103,697 probably null Het
Zfp9 A G 6: 118,464,976 Y242H probably damaging Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53524443 missense probably damaging 1.00
IGL00466:Atm APN 9 53499112 splice site probably benign
IGL00567:Atm APN 9 53503116 nonsense probably null
IGL00702:Atm APN 9 53511831 missense probably benign 0.02
IGL00743:Atm APN 9 53513116 missense probably benign 0.00
IGL00771:Atm APN 9 53493054 missense probably benign 0.01
IGL00773:Atm APN 9 53522144 missense probably benign 0.00
IGL00819:Atm APN 9 53518531 missense probably damaging 1.00
IGL00864:Atm APN 9 53533933 missense probably damaging 0.99
IGL00985:Atm APN 9 53459816 missense probably damaging 0.98
IGL01109:Atm APN 9 53490293 missense probably damaging 1.00
IGL01120:Atm APN 9 53461122 critical splice acceptor site probably null
IGL01369:Atm APN 9 53515317 missense probably benign
IGL01374:Atm APN 9 53531724 missense possibly damaging 0.58
IGL01406:Atm APN 9 53439746 makesense probably null
IGL01409:Atm APN 9 53499171 missense probably benign 0.01
IGL01434:Atm APN 9 53507807 missense probably benign 0.04
IGL01486:Atm APN 9 53510213 missense probably benign
IGL01583:Atm APN 9 53484247 splice site probably benign
IGL01861:Atm APN 9 53494612 missense probably null 0.89
IGL01865:Atm APN 9 53461002 missense probably damaging 1.00
IGL02026:Atm APN 9 53442417 splice site probably null
IGL02072:Atm APN 9 53459796 missense probably benign 0.01
IGL02075:Atm APN 9 53527237 missense probably damaging 1.00
IGL02127:Atm APN 9 53487983 missense probably damaging 1.00
IGL02175:Atm APN 9 53480665 missense probably damaging 0.99
IGL02246:Atm APN 9 53527185 missense probably benign 0.12
IGL02259:Atm APN 9 53518494 splice site probably benign
IGL02351:Atm APN 9 53522176 missense probably benign 0.04
IGL02358:Atm APN 9 53522176 missense probably benign 0.04
IGL02387:Atm APN 9 53479766 splice site probably null
IGL02417:Atm APN 9 53479695 missense probably benign 0.00
IGL02422:Atm APN 9 53500792 missense probably damaging 1.00
IGL02445:Atm APN 9 53454330 missense probably benign 0.00
IGL02492:Atm APN 9 53455859 missense probably damaging 0.99
IGL02513:Atm APN 9 53497262 splice site probably benign
IGL02633:Atm APN 9 53448153 missense probably damaging 1.00
IGL02634:Atm APN 9 53516563 missense probably benign 0.00
IGL02948:Atm APN 9 53453440 splice site probably benign
IGL02959:Atm APN 9 53471418 missense probably damaging 1.00
IGL02965:Atm APN 9 53453563 missense probably damaging 1.00
IGL03085:Atm APN 9 53484171 missense possibly damaging 0.89
antebellum UTSW 9 53518559 nonsense probably null
bull_run UTSW 9 53487922 missense probably benign 0.09
Civil UTSW 9 53492268 missense possibly damaging 0.78
gettysburg UTSW 9 53455988 splice site probably null
Grant UTSW 9 53511917 nonsense probably null
mockingbird UTSW 9 53516467 nonsense probably null
mockingbird2 UTSW 9 53488587 missense probably damaging 1.00
osphere UTSW 9 53479673 missense probably damaging 0.99
shiloh UTSW 9 53465298 missense probably damaging 1.00
Strato UTSW 9 53503018 missense probably damaging 1.00
thrasher UTSW 9 53445507 missense probably benign 0.01
Tropo UTSW 9 53531648 missense probably damaging 1.00
P0019:Atm UTSW 9 53465028 splice site probably benign
PIT4403001:Atm UTSW 9 53500982 missense probably benign
PIT4687001:Atm UTSW 9 53486812 critical splice donor site probably null
R0004:Atm UTSW 9 53453528 splice site probably benign
R0035:Atm UTSW 9 53513180 missense probably benign 0.01
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0201:Atm UTSW 9 53454279 splice site probably benign
R0304:Atm UTSW 9 53516344 missense probably benign 0.34
R0308:Atm UTSW 9 53454473 splice site probably null
R0362:Atm UTSW 9 53458838 missense possibly damaging 0.90
R0470:Atm UTSW 9 53460966 missense probably damaging 1.00
R0513:Atm UTSW 9 53503948 missense probably benign 0.00
R0589:Atm UTSW 9 53490192 missense possibly damaging 0.51
R0617:Atm UTSW 9 53458941 nonsense probably null
R0630:Atm UTSW 9 53531622 splice site probably benign
R0652:Atm UTSW 9 53486014 missense probably damaging 0.98
R0698:Atm UTSW 9 53515239 missense probably damaging 1.00
R0737:Atm UTSW 9 53456566 missense probably damaging 1.00
R0885:Atm UTSW 9 53459823 missense probably benign
R0947:Atm UTSW 9 53504092 missense probably benign 0.01
R0948:Atm UTSW 9 53495958 missense probably benign
R1144:Atm UTSW 9 53511698 splice site probably benign
R1252:Atm UTSW 9 53455840 missense probably damaging 1.00
R1295:Atm UTSW 9 53456530 missense probably damaging 1.00
R1296:Atm UTSW 9 53456530 missense probably damaging 1.00
R1419:Atm UTSW 9 53457489 missense probably benign 0.00
R1477:Atm UTSW 9 53464273 missense probably benign 0.00
R1596:Atm UTSW 9 53453378 missense probably damaging 1.00
R1630:Atm UTSW 9 53479673 missense probably damaging 0.99
R1667:Atm UTSW 9 53500932 missense probably damaging 1.00
R1681:Atm UTSW 9 53522155 missense possibly damaging 0.94
R1703:Atm UTSW 9 53500700 missense probably benign
R1817:Atm UTSW 9 53492233 splice site probably benign
R1840:Atm UTSW 9 53456530 missense probably damaging 1.00
R1848:Atm UTSW 9 53468012 missense probably benign 0.06
R1906:Atm UTSW 9 53506568 missense probably damaging 1.00
R1958:Atm UTSW 9 53471418 missense probably damaging 1.00
R2108:Atm UTSW 9 53443997 missense probably damaging 1.00
R2116:Atm UTSW 9 53500969 missense probably benign 0.36
R2134:Atm UTSW 9 53467964 critical splice donor site probably null
R2137:Atm UTSW 9 53453375 missense probably damaging 1.00
R2291:Atm UTSW 9 53490909 splice site probably null
R2348:Atm UTSW 9 53492268 missense possibly damaging 0.78
R2483:Atm UTSW 9 53510266 missense probably damaging 1.00
R2567:Atm UTSW 9 53457470 missense possibly damaging 0.72
R2897:Atm UTSW 9 53507805 missense probably damaging 0.99
R2939:Atm UTSW 9 53494711 missense probably damaging 1.00
R3008:Atm UTSW 9 53480750 missense probably benign 0.00
R3236:Atm UTSW 9 53479748 missense probably benign 0.15
R3847:Atm UTSW 9 53503075 missense possibly damaging 0.94
R3889:Atm UTSW 9 53506636 splice site probably benign
R3919:Atm UTSW 9 53492278 missense probably benign 0.00
R4125:Atm UTSW 9 53450621 missense probably damaging 1.00
R4222:Atm UTSW 9 53480669 missense probably benign
R4395:Atm UTSW 9 53465227 missense probably benign 0.09
R4466:Atm UTSW 9 53448169 nonsense probably null
R4502:Atm UTSW 9 53495946 missense possibly damaging 0.92
R4514:Atm UTSW 9 53493039 missense probably damaging 0.99
R4528:Atm UTSW 9 53500759 missense probably benign 0.39
R4593:Atm UTSW 9 53453594 missense possibly damaging 0.55
R4634:Atm UTSW 9 53531733 missense probably benign 0.01
R4665:Atm UTSW 9 53464229 missense probably benign 0.00
R4672:Atm UTSW 9 53522201 missense probably damaging 0.99
R4741:Atm UTSW 9 53453607 missense probably benign 0.10
R4808:Atm UTSW 9 53445495 missense probably damaging 0.99
R4959:Atm UTSW 9 53515301 missense probably benign
R4996:Atm UTSW 9 53524507 missense probably benign 0.09
R5030:Atm UTSW 9 53520109 nonsense probably null
R5214:Atm UTSW 9 53491027 missense probably benign 0.09
R5260:Atm UTSW 9 53506611 missense probably damaging 0.99
R5311:Atm UTSW 9 53518623 missense probably benign 0.00
R5394:Atm UTSW 9 53507777 critical splice donor site probably null
R5400:Atm UTSW 9 53503018 missense probably damaging 1.00
R5436:Atm UTSW 9 53459804 missense probably benign 0.00
R5441:Atm UTSW 9 53516467 nonsense probably null
R5569:Atm UTSW 9 53516450 nonsense probably null
R5856:Atm UTSW 9 53495955 missense possibly damaging 0.64
R5891:Atm UTSW 9 53497159 missense probably benign
R5910:Atm UTSW 9 53448080 missense probably damaging 0.96
R6054:Atm UTSW 9 53459873 missense probably damaging 1.00
R6062:Atm UTSW 9 53488587 missense probably damaging 1.00
R6092:Atm UTSW 9 53524414 missense probably damaging 1.00
R6127:Atm UTSW 9 53524509 missense probably damaging 1.00
R6160:Atm UTSW 9 53490959 missense probably benign 0.04
R6267:Atm UTSW 9 53444000 missense probably damaging 1.00
R6273:Atm UTSW 9 53487922 missense probably benign 0.09
R6284:Atm UTSW 9 53445376 splice site probably null
R6478:Atm UTSW 9 53490254 missense probably damaging 1.00
R6547:Atm UTSW 9 53440157 missense probably damaging 1.00
R6549:Atm UTSW 9 53493177 missense probably benign 0.00
R6704:Atm UTSW 9 53458853 missense probably benign 0.02
R6715:Atm UTSW 9 53531648 missense probably damaging 1.00
R6737:Atm UTSW 9 53486051 missense probably benign 0.30
R6759:Atm UTSW 9 53518559 nonsense probably null
R6766:Atm UTSW 9 53490282 missense probably damaging 0.99
R6813:Atm UTSW 9 53497235 missense probably benign 0.00
R6852:Atm UTSW 9 53482430 missense possibly damaging 0.93
R7064:Atm UTSW 9 53507881 missense probably benign 0.02
R7208:Atm UTSW 9 53512008 splice site probably null
R7211:Atm UTSW 9 53488560 missense probably benign 0.01
R7220:Atm UTSW 9 53511917 nonsense probably null
R7336:Atm UTSW 9 53462503 missense possibly damaging 0.47
R7363:Atm UTSW 9 53465298 missense probably damaging 1.00
R7378:Atm UTSW 9 53453437 critical splice acceptor site probably null
R7472:Atm UTSW 9 53448125 missense possibly damaging 0.81
R7487:Atm UTSW 9 53524354 missense probably benign
R7497:Atm UTSW 9 53511891 missense probably benign 0.00
R7584:Atm UTSW 9 53513127 missense probably damaging 0.99
R7624:Atm UTSW 9 53454768 missense probably damaging 0.99
R7653:Atm UTSW 9 53490302 nonsense probably null
R7660:Atm UTSW 9 53445507 missense probably benign 0.01
R7679:Atm UTSW 9 53442497 missense probably damaging 1.00
R7720:Atm UTSW 9 53522239 missense possibly damaging 0.54
R8221:Atm UTSW 9 53455988 splice site probably null
R8247:Atm UTSW 9 53450570 missense
R8334:Atm UTSW 9 53522273 missense probably benign 0.00
R8503:Atm UTSW 9 53488052 missense probably damaging 0.99
R8552:Atm UTSW 9 53524497 missense probably damaging 1.00
R8749:Atm UTSW 9 53499197 nonsense probably null
X0067:Atm UTSW 9 53479694 missense probably benign 0.00
Z1088:Atm UTSW 9 53531687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCACGTACTCTGCCAAG -3'
(R):5'- TTGCTGGAAGTTACGATGGC -3'

Sequencing Primer
(F):5'- TCTGCCAAGAGCTAAACCAAG -3'
(R):5'- TGGCAACAGCAGAGAGC -3'
Posted On2015-10-08