Incidental Mutation 'R4627:Cobl'
ID348887
Institutional Source Beutler Lab
Gene Symbol Cobl
Ensembl Gene ENSMUSG00000020173
Gene Namecordon-bleu WH2 repeat
SynonymsC530045F18Rik
MMRRC Submission 041892-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4627 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location12236608-12464960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12251093 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1214 (E1214G)
Ref Sequence ENSEMBL: ENSMUSP00000133470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046755] [ENSMUST00000109650] [ENSMUST00000109651] [ENSMUST00000172919] [ENSMUST00000172956] [ENSMUST00000174874]
Predicted Effect probably damaging
Transcript: ENSMUST00000046755
AA Change: E1221G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045693
Gene: ENSMUSG00000020173
AA Change: E1221G

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 144 235 2.2e-46 PFAM
low complexity region 328 333 N/A INTRINSIC
low complexity region 360 376 N/A INTRINSIC
low complexity region 408 433 N/A INTRINSIC
low complexity region 468 482 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
coiled coil region 564 589 N/A INTRINSIC
WH2 1185 1205 1.32e0 SMART
WH2 1225 1245 6.36e-3 SMART
low complexity region 1276 1296 N/A INTRINSIC
WH2 1313 1333 3.91e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109650
AA Change: E1139G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105277
Gene: ENSMUSG00000020173
AA Change: E1139G

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.6e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
coiled coil region 482 507 N/A INTRINSIC
WH2 1103 1123 1.32e0 SMART
WH2 1143 1163 6.36e-3 SMART
low complexity region 1194 1214 N/A INTRINSIC
WH2 1231 1251 3.91e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109651
AA Change: E1196G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105278
Gene: ENSMUSG00000020173
AA Change: E1196G

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.2e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 383 408 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
coiled coil region 539 564 N/A INTRINSIC
WH2 1160 1180 1.32e0 SMART
WH2 1200 1220 6.36e-3 SMART
low complexity region 1251 1271 N/A INTRINSIC
WH2 1288 1308 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172919
SMART Domains Protein: ENSMUSP00000133669
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.6e-41 PFAM
low complexity region 328 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172956
SMART Domains Protein: ENSMUSP00000134372
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.4e-41 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174874
AA Change: E1214G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133470
Gene: ENSMUSG00000020173
AA Change: E1214G

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
Pfam:Cobl 175 253 1.2e-40 PFAM
low complexity region 321 326 N/A INTRINSIC
low complexity region 353 369 N/A INTRINSIC
low complexity region 401 426 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
low complexity region 519 534 N/A INTRINSIC
coiled coil region 557 582 N/A INTRINSIC
WH2 1178 1198 1.32e0 SMART
WH2 1218 1238 6.36e-3 SMART
low complexity region 1269 1289 N/A INTRINSIC
WH2 1306 1326 3.91e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains WH2 domains (WASP, Wiskott-Aldrich syndrome protein, homology domain-2) that interact with actin. The encoded actin regulator protein is required for growth and assembly of brush border microvilli that play a role in maintaining intestinal homeostasis. A similar protein in mouse functions in midbrain neural tube closure. A pseudogene of this gene is located on chromosome X. [provided by RefSeq, Oct 2016]
PHENOTYPE: Animals homozygous for this mutation do not display a phenotype. However, the allele exacerbates the neural tube defects seen in the loop tail mouse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Adam6a A T 12: 113,544,949 D314V probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Adamtsl2 T A 2: 27,093,585 L331Q probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Aldoart1 T C 4: 72,852,443 T43A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ano7 T C 1: 93,375,185 I15T probably benign Het
Aox3 A T 1: 58,125,035 T155S probably damaging Het
Ap2a1 C T 7: 44,904,419 V535M probably damaging Het
Apbb2 C T 5: 66,400,076 probably null Het
Astn1 C A 1: 158,502,251 H225Q possibly damaging Het
Atm A G 9: 53,456,506 I2439T possibly damaging Het
Atp1b2 T A 11: 69,601,334 I263F probably damaging Het
Ccdc184 A T 15: 98,168,757 N148Y probably benign Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Cep192 C G 18: 67,812,369 P180R probably benign Het
Cfap46 T C 7: 139,657,281 Y571C probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chchd6 G A 6: 89,384,660 L226F probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cpsf2 G A 12: 101,989,895 R319Q probably benign Het
Csdc2 T C 15: 81,949,123 V107A probably benign Het
Csmd1 A G 8: 16,697,917 W273R probably benign Het
Diexf T C 1: 193,107,695 T719A probably benign Het
Dnah2 T A 11: 69,465,376 N2156I probably damaging Het
Dsp A G 13: 38,168,641 Y165C probably benign Het
Exoc1 T C 5: 76,542,228 V205A probably benign Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fbln2 G T 6: 91,259,767 V755L probably damaging Het
Fhad1 A T 4: 141,896,468 V1371D possibly damaging Het
Folh1 A T 7: 86,773,252 M59K probably benign Het
Foxf2 A T 13: 31,626,888 H270L probably benign Het
Gm14401 G A 2: 177,086,316 R65H probably benign Het
Gpn1 C A 5: 31,498,393 Y592* probably null Het
Hmcn1 T G 1: 150,595,894 D4903A probably benign Het
Hnf1a T C 5: 114,955,871 R220G probably damaging Het
Hoxd10 G A 2: 74,692,292 A105T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 C T 12: 25,057,042 T1498I possibly damaging Het
Klhl2 G T 8: 64,758,191 Y274* probably null Het
Lmbrd1 A G 1: 24,705,999 Y140C probably damaging Het
Mapk8ip3 G A 17: 24,903,293 T706I probably benign Het
Mast4 A C 13: 103,334,021 S58A possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mmachc A T 4: 116,703,471 S276T probably damaging Het
Nfat5 A T 8: 107,369,276 Q1289L probably damaging Het
Nlrc4 G T 17: 74,446,628 F253L probably damaging Het
Nr1i3 C A 1: 171,216,445 A112E probably benign Het
Olfr1367 T C 13: 21,347,464 F179L probably damaging Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr455 T A 6: 42,538,441 T194S possibly damaging Het
Olfr853 G T 9: 19,537,673 Q86K possibly damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pde10a A C 17: 8,981,652 D779A probably damaging Het
Pde4b T C 4: 102,601,605 L486S probably damaging Het
Pex2 A T 3: 5,561,281 I156N probably damaging Het
Phtf2 C T 5: 20,773,740 R63Q probably damaging Het
Prag1 A G 8: 36,103,292 Y343C probably damaging Het
Prdm16 A T 4: 154,367,240 Y170N probably damaging Het
Prpf6 A C 2: 181,601,474 K5T probably damaging Het
Ptpn1 A G 2: 167,967,781 K103R probably benign Het
Ralgapa2 A G 2: 146,361,453 S1159P possibly damaging Het
Rapgef3 G T 15: 97,758,929 D318E probably damaging Het
Ripk4 A T 16: 97,744,026 S474T probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Sec16a A G 2: 26,429,393 V1491A probably damaging Het
Sec16a C T 2: 26,431,068 probably null Het
Setd7 G T 3: 51,542,665 N113K probably damaging Het
Shank2 C T 7: 144,411,424 T1502M probably damaging Het
Skor1 A T 9: 63,145,476 C376S probably damaging Het
Slc12a3 A T 8: 94,329,384 L49F probably benign Het
Slc35d3 C T 10: 19,849,331 V260M probably damaging Het
Slc46a1 T A 11: 78,466,889 V256E probably benign Het
Slc6a1 T C 6: 114,308,106 S127P probably benign Het
Syngr4 A G 7: 45,887,028 L190P probably damaging Het
Tagap G A 17: 7,926,941 probably null Het
Tamm41 A T 6: 115,035,002 N89K probably benign Het
Tbc1d31 T A 15: 57,967,912 M922K probably benign Het
Tbk1 T C 10: 121,568,080 N254S possibly damaging Het
Tfec A G 6: 16,840,479 S140P probably damaging Het
Tnrc18 T C 5: 142,740,128 E1802G unknown Het
Tom1l2 C T 11: 60,242,707 probably null Het
Tonsl T G 15: 76,637,224 K323Q probably damaging Het
Tsnaxip1 A T 8: 105,841,407 E268D probably damaging Het
Ttf1 C A 2: 29,065,160 H179N possibly damaging Het
Ttn T C 2: 76,726,173 S30163G probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Ugt1a10 G A 1: 88,218,390 R519Q probably damaging Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vwa8 G A 14: 79,103,697 probably null Het
Zfp9 A G 6: 118,464,976 Y242H probably damaging Het
Other mutations in Cobl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cobl APN 11 12375813 missense possibly damaging 0.89
IGL00698:Cobl APN 11 12253722 missense probably benign 0.41
IGL00772:Cobl APN 11 12266985 missense probably benign 0.02
IGL00922:Cobl APN 11 12254866 missense probably damaging 1.00
IGL00985:Cobl APN 11 12254843 missense probably damaging 1.00
IGL01641:Cobl APN 11 12309641 nonsense probably null
IGL01722:Cobl APN 11 12253987 missense probably benign 0.00
IGL01734:Cobl APN 11 12254980 splice site probably benign
IGL01924:Cobl APN 11 12254596 missense probably benign 0.30
IGL02105:Cobl APN 11 12249651 missense probably damaging 1.00
IGL02326:Cobl APN 11 12386712 missense possibly damaging 0.69
IGL02342:Cobl APN 11 12253672 missense possibly damaging 0.64
IGL02426:Cobl APN 11 12254351 nonsense probably null
IGL02754:Cobl APN 11 12254371 missense probably damaging 1.00
IGL02754:Cobl APN 11 12254370 missense probably damaging 1.00
IGL02811:Cobl APN 11 12253285 missense possibly damaging 0.56
IGL02859:Cobl APN 11 12369602 missense probably damaging 1.00
IGL02999:Cobl APN 11 12343869 missense possibly damaging 0.71
IGL03030:Cobl APN 11 12254241 missense possibly damaging 0.80
IGL03191:Cobl APN 11 12253364 missense probably benign 0.00
PIT4418001:Cobl UTSW 11 12256240 missense possibly damaging 0.79
PIT4480001:Cobl UTSW 11 12253592 missense probably benign
PIT4495001:Cobl UTSW 11 12254596 missense probably benign 0.00
R0031:Cobl UTSW 11 12254945 missense probably benign 0.36
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0322:Cobl UTSW 11 12267072 missense probably damaging 1.00
R0597:Cobl UTSW 11 12254699 missense probably benign 0.24
R0733:Cobl UTSW 11 12365167 missense probably benign 0.31
R0734:Cobl UTSW 11 12375971 missense probably damaging 1.00
R0784:Cobl UTSW 11 12266843 splice site probably benign
R0884:Cobl UTSW 11 12375908 missense possibly damaging 0.89
R1065:Cobl UTSW 11 12254327 missense possibly damaging 0.67
R1331:Cobl UTSW 11 12375853 missense probably damaging 0.96
R1892:Cobl UTSW 11 12253258 missense probably damaging 0.99
R2847:Cobl UTSW 11 12378342 missense probably damaging 1.00
R2848:Cobl UTSW 11 12378342 missense probably damaging 1.00
R3407:Cobl UTSW 11 12375830 missense probably damaging 1.00
R4662:Cobl UTSW 11 12253672 missense probably benign 0.08
R4677:Cobl UTSW 11 12386665 missense possibly damaging 0.93
R4844:Cobl UTSW 11 12254740 missense probably benign 0.10
R4942:Cobl UTSW 11 12254185 missense probably damaging 0.99
R5158:Cobl UTSW 11 12256198 missense possibly damaging 0.84
R5195:Cobl UTSW 11 12253565 missense probably benign 0.02
R5255:Cobl UTSW 11 12375825 missense probably damaging 1.00
R5588:Cobl UTSW 11 12343886 nonsense probably null
R5637:Cobl UTSW 11 12296531 intron probably benign
R5643:Cobl UTSW 11 12306948 splice site probably benign
R5749:Cobl UTSW 11 12266965 missense possibly damaging 0.86
R5953:Cobl UTSW 11 12256220 missense probably benign 0.00
R6000:Cobl UTSW 11 12369684 missense probably benign 0.08
R6373:Cobl UTSW 11 12253118 missense probably damaging 1.00
R7034:Cobl UTSW 11 12254177 missense probably damaging 1.00
R7071:Cobl UTSW 11 12254795 missense probably benign 0.00
R7077:Cobl UTSW 11 12253441 missense probably benign 0.04
R7078:Cobl UTSW 11 12378271 missense probably damaging 1.00
R7099:Cobl UTSW 11 12296540 missense
R7153:Cobl UTSW 11 12254128 missense probably damaging 1.00
R7448:Cobl UTSW 11 12256225 missense possibly damaging 0.46
R7519:Cobl UTSW 11 12253124 missense probably damaging 1.00
R7767:Cobl UTSW 11 12412117 start gained probably benign
R7772:Cobl UTSW 11 12254488 missense probably benign 0.29
R7841:Cobl UTSW 11 12253324 missense probably damaging 1.00
R7845:Cobl UTSW 11 12365139 missense probably benign 0.35
R7924:Cobl UTSW 11 12253324 missense probably damaging 1.00
R7928:Cobl UTSW 11 12365139 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CCGTGTAGTTAGAGCAATGGATG -3'
(R):5'- CCCAAATCTATAGCCTTGGCTC -3'

Sequencing Primer
(F):5'- GCTAAGTGGCATTGGCTTAGTC -3'
(R):5'- CTCGAAGACTGTTCTACACATGTG -3'
Posted On2015-10-08