Incidental Mutation 'R4627:Dnah2'
ID348889
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Namedynein, axonemal, heavy chain 2
SynonymsDnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik
MMRRC Submission 041892-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4627 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69420809-69549110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69465376 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 2156 (N2156I)
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
Predicted Effect probably damaging
Transcript: ENSMUST00000035539
AA Change: N2150I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: N2150I

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108659
AA Change: N2156I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: N2156I

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151811
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Adam6a A T 12: 113,544,949 D314V probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Adamtsl2 T A 2: 27,093,585 L331Q probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Aldoart1 T C 4: 72,852,443 T43A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ano7 T C 1: 93,375,185 I15T probably benign Het
Aox3 A T 1: 58,125,035 T155S probably damaging Het
Ap2a1 C T 7: 44,904,419 V535M probably damaging Het
Apbb2 C T 5: 66,400,076 probably null Het
Astn1 C A 1: 158,502,251 H225Q possibly damaging Het
Atm A G 9: 53,456,506 I2439T possibly damaging Het
Atp1b2 T A 11: 69,601,334 I263F probably damaging Het
Ccdc184 A T 15: 98,168,757 N148Y probably benign Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Cep192 C G 18: 67,812,369 P180R probably benign Het
Cfap46 T C 7: 139,657,281 Y571C probably damaging Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chchd6 G A 6: 89,384,660 L226F probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cobl T C 11: 12,251,093 E1214G probably damaging Het
Cpsf2 G A 12: 101,989,895 R319Q probably benign Het
Csdc2 T C 15: 81,949,123 V107A probably benign Het
Csmd1 A G 8: 16,697,917 W273R probably benign Het
Diexf T C 1: 193,107,695 T719A probably benign Het
Dsp A G 13: 38,168,641 Y165C probably benign Het
Exoc1 T C 5: 76,542,228 V205A probably benign Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fbln2 G T 6: 91,259,767 V755L probably damaging Het
Fhad1 A T 4: 141,896,468 V1371D possibly damaging Het
Folh1 A T 7: 86,773,252 M59K probably benign Het
Foxf2 A T 13: 31,626,888 H270L probably benign Het
Gm14401 G A 2: 177,086,316 R65H probably benign Het
Gpn1 C A 5: 31,498,393 Y592* probably null Het
Hmcn1 T G 1: 150,595,894 D4903A probably benign Het
Hnf1a T C 5: 114,955,871 R220G probably damaging Het
Hoxd10 G A 2: 74,692,292 A105T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 C T 12: 25,057,042 T1498I possibly damaging Het
Klhl2 G T 8: 64,758,191 Y274* probably null Het
Lmbrd1 A G 1: 24,705,999 Y140C probably damaging Het
Mapk8ip3 G A 17: 24,903,293 T706I probably benign Het
Mast4 A C 13: 103,334,021 S58A possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mmachc A T 4: 116,703,471 S276T probably damaging Het
Nfat5 A T 8: 107,369,276 Q1289L probably damaging Het
Nlrc4 G T 17: 74,446,628 F253L probably damaging Het
Nr1i3 C A 1: 171,216,445 A112E probably benign Het
Olfr1367 T C 13: 21,347,464 F179L probably damaging Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr455 T A 6: 42,538,441 T194S possibly damaging Het
Olfr853 G T 9: 19,537,673 Q86K possibly damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pde10a A C 17: 8,981,652 D779A probably damaging Het
Pde4b T C 4: 102,601,605 L486S probably damaging Het
Pex2 A T 3: 5,561,281 I156N probably damaging Het
Phtf2 C T 5: 20,773,740 R63Q probably damaging Het
Prag1 A G 8: 36,103,292 Y343C probably damaging Het
Prdm16 A T 4: 154,367,240 Y170N probably damaging Het
Prpf6 A C 2: 181,601,474 K5T probably damaging Het
Ptpn1 A G 2: 167,967,781 K103R probably benign Het
Ralgapa2 A G 2: 146,361,453 S1159P possibly damaging Het
Rapgef3 G T 15: 97,758,929 D318E probably damaging Het
Ripk4 A T 16: 97,744,026 S474T probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Sec16a A G 2: 26,429,393 V1491A probably damaging Het
Sec16a C T 2: 26,431,068 probably null Het
Setd7 G T 3: 51,542,665 N113K probably damaging Het
Shank2 C T 7: 144,411,424 T1502M probably damaging Het
Skor1 A T 9: 63,145,476 C376S probably damaging Het
Slc12a3 A T 8: 94,329,384 L49F probably benign Het
Slc35d3 C T 10: 19,849,331 V260M probably damaging Het
Slc46a1 T A 11: 78,466,889 V256E probably benign Het
Slc6a1 T C 6: 114,308,106 S127P probably benign Het
Syngr4 A G 7: 45,887,028 L190P probably damaging Het
Tagap G A 17: 7,926,941 probably null Het
Tamm41 A T 6: 115,035,002 N89K probably benign Het
Tbc1d31 T A 15: 57,967,912 M922K probably benign Het
Tbk1 T C 10: 121,568,080 N254S possibly damaging Het
Tfec A G 6: 16,840,479 S140P probably damaging Het
Tnrc18 T C 5: 142,740,128 E1802G unknown Het
Tom1l2 C T 11: 60,242,707 probably null Het
Tonsl T G 15: 76,637,224 K323Q probably damaging Het
Tsnaxip1 A T 8: 105,841,407 E268D probably damaging Het
Ttf1 C A 2: 29,065,160 H179N possibly damaging Het
Ttn T C 2: 76,726,173 S30163G probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Ugt1a10 G A 1: 88,218,390 R519Q probably damaging Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vwa8 G A 14: 79,103,697 probably null Het
Zfp9 A G 6: 118,464,976 Y242H probably damaging Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69492672 missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69495066 splice site probably benign
IGL00772:Dnah2 APN 11 69451257 missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69473350 critical splice donor site probably null
IGL00827:Dnah2 APN 11 69448457 missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69478092 missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69493184 missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69475606 missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69432964 missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69474191 splice site probably benign
IGL01480:Dnah2 APN 11 69458371 missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69516080 missense probably benign 0.17
IGL01592:Dnah2 APN 11 69431087 missense probably benign 0.14
IGL01612:Dnah2 APN 11 69465063 splice site probably benign
IGL01667:Dnah2 APN 11 69544395 missense probably benign
IGL01667:Dnah2 APN 11 69520941 missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69539443 missense probably benign
IGL02019:Dnah2 APN 11 69474285 missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69499212 missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69422559 missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69458185 missense probably benign 0.07
IGL02158:Dnah2 APN 11 69458123 missense probably benign
IGL02381:Dnah2 APN 11 69446292 missense probably benign 0.25
IGL02681:Dnah2 APN 11 69452933 missense probably benign 0.40
IGL02957:Dnah2 APN 11 69448507 missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69518414 missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69521187 missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69436291 splice site probably benign
IGL03120:Dnah2 APN 11 69421848 missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69458488 missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69459263 missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69529381 critical splice donor site probably null
IGL03333:Dnah2 APN 11 69495123 missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69496577 missense probably benign 0.13
argyrios UTSW 11 69516590 missense possibly damaging 0.47
Aureus UTSW 11 69429348 missense probably damaging 1.00
platinum UTSW 11 69458042 missense probably damaging 0.96
R0334_dnah2_144 UTSW 11 69436836 missense probably damaging 1.00
R2150_dnah2_212 UTSW 11 69515761 missense probably benign 0.14
BB005:Dnah2 UTSW 11 69430835 missense probably damaging 0.98
BB015:Dnah2 UTSW 11 69430835 missense probably damaging 0.98
E0370:Dnah2 UTSW 11 69515615 splice site probably null
P0026:Dnah2 UTSW 11 69464947 missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69421009 missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69435249 missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69436836 missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69529531 missense probably benign 0.00
R0386:Dnah2 UTSW 11 69447861 missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69499238 missense probably benign 0.26
R0427:Dnah2 UTSW 11 69452879 missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69459288 missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69448542 missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69459201 missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69423126 missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69499194 missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69477683 missense probably benign 0.07
R0924:Dnah2 UTSW 11 69421308 missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69448519 missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69447819 missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69446648 missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69499190 missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69515700 missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69451050 missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69520667 splice site probably null
R1538:Dnah2 UTSW 11 69477202 missense probably benign 0.17
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1590:Dnah2 UTSW 11 69422754 critical splice donor site probably null
R1590:Dnah2 UTSW 11 69521198 missense probably benign 0.00
R1655:Dnah2 UTSW 11 69473854 missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69514691 missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69497889 missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69423543 missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69475574 missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69514804 missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69437886 missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69515752 missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69464930 missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69474325 missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69458358 critical splice donor site probably null
R2016:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69524240 missense probably benign 0.14
R2077:Dnah2 UTSW 11 69496606 missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69455916 missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69493237 missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2128:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2146:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2147:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2150:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2404:Dnah2 UTSW 11 69437221 missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69524206 nonsense probably null
R2517:Dnah2 UTSW 11 69516644 missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69430478 missense probably benign
R3741:Dnah2 UTSW 11 69448469 missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69492650 splice site probably null
R3872:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69451347 missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69454103 missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69484021 missense probably benign 0.00
R4501:Dnah2 UTSW 11 69477659 missense probably benign
R4515:Dnah2 UTSW 11 69465631 missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69483367 missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69463661 missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69496559 missense probably benign 0.00
R4683:Dnah2 UTSW 11 69458942 missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69498532 missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69478077 missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69516590 missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69476688 missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69429357 missense probably benign 0.00
R4740:Dnah2 UTSW 11 69458042 missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69473871 missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69423205 missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69422590 missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69463648 missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69476691 missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69521147 missense probably benign 0.00
R4911:Dnah2 UTSW 11 69499104 critical splice donor site probably null
R4954:Dnah2 UTSW 11 69539496 missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69455973 nonsense probably null
R5015:Dnah2 UTSW 11 69497882 missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69448166 missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69520773 missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69520933 missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69422536 missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69435884 missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5208:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5252:Dnah2 UTSW 11 69529469 missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5298:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5299:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5301:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5324:Dnah2 UTSW 11 69457993 missense probably benign 0.07
R5350:Dnah2 UTSW 11 69516036 missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69421848 missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69500857 missense probably benign
R5421:Dnah2 UTSW 11 69435636 missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69524383 missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69473351 critical splice donor site probably null
R5474:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5476:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5477:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5510:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5527:Dnah2 UTSW 11 69437188 nonsense probably null
R5566:Dnah2 UTSW 11 69516569 nonsense probably null
R5587:Dnah2 UTSW 11 69437242 missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5688:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5690:Dnah2 UTSW 11 69491544 missense probably benign 0.15
R5711:Dnah2 UTSW 11 69435390 missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69430817 missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5913:Dnah2 UTSW 11 69448430 missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5960:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5961:Dnah2 UTSW 11 69431148 missense probably damaging 1.00
R5961:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5977:Dnah2 UTSW 11 69520881 missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69500839 missense probably benign
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6050:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6086:Dnah2 UTSW 11 69516008 missense probably benign 0.30
R6115:Dnah2 UTSW 11 69446649 missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69518359 missense probably benign 0.29
R6159:Dnah2 UTSW 11 69458542 missense probably damaging 1.00
R6159:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6163:Dnah2 UTSW 11 69520903 nonsense probably null
R6171:Dnah2 UTSW 11 69423042 missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69457412 missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69491641 missense probably benign 0.25
R6352:Dnah2 UTSW 11 69448227 missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69458518 missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69539415 missense probably benign
R6478:Dnah2 UTSW 11 69516010 missense probably benign 0.01
R6516:Dnah2 UTSW 11 69465386 missense probably benign 0.34
R6538:Dnah2 UTSW 11 69437197 missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69423690 missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69455963 missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69429471 missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69484260 missense probably benign 0.12
R6935:Dnah2 UTSW 11 69421741 missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69491547 nonsense probably null
R7073:Dnah2 UTSW 11 69430492 nonsense probably null
R7111:Dnah2 UTSW 11 69446753 splice site probably null
R7125:Dnah2 UTSW 11 69436182 missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69491555 missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69549097 splice site probably null
R7214:Dnah2 UTSW 11 69431109 missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69421396 missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69459146 critical splice donor site probably null
R7256:Dnah2 UTSW 11 69431094 missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69500817 missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69478797 missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69492805 missense probably benign 0.25
R7437:Dnah2 UTSW 11 69498627 missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7473:Dnah2 UTSW 11 69491658 missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69500796 missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7615:Dnah2 UTSW 11 69435304 missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69498685 missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69451318 nonsense probably null
R7764:Dnah2 UTSW 11 69458158 missense probably benign 0.29
R7793:Dnah2 UTSW 11 69495214 missense probably benign 0.00
R7819:Dnah2 UTSW 11 69516593 missense probably benign 0.01
R7881:Dnah2 UTSW 11 69431238 missense probably damaging 1.00
R7900:Dnah2 UTSW 11 69518428 missense probably damaging 1.00
R7916:Dnah2 UTSW 11 69421148 critical splice acceptor site probably null
R7921:Dnah2 UTSW 11 69520834 missense probably benign
R7928:Dnah2 UTSW 11 69430835 missense probably damaging 0.98
R7937:Dnah2 UTSW 11 69517685 nonsense probably null
R7995:Dnah2 UTSW 11 69520737 missense possibly damaging 0.77
R8202:Dnah2 UTSW 11 69478823 missense probably benign 0.00
R8208:Dnah2 UTSW 11 69520852 missense probably benign 0.05
R8215:Dnah2 UTSW 11 69435367 missense probably damaging 1.00
R8279:Dnah2 UTSW 11 69475573 missense probably damaging 1.00
R8338:Dnah2 UTSW 11 69487296 missense probably damaging 1.00
R8348:Dnah2 UTSW 11 69429447 missense possibly damaging 0.95
R8405:Dnah2 UTSW 11 69458463 missense probably damaging 1.00
R8407:Dnah2 UTSW 11 69459278 missense probably benign 0.00
R8493:Dnah2 UTSW 11 69452978 missense probably damaging 1.00
R8673:Dnah2 UTSW 11 69514697 missense probably benign 0.23
R8725:Dnah2 UTSW 11 69524179 missense probably damaging 1.00
R8727:Dnah2 UTSW 11 69524179 missense probably damaging 1.00
R8730:Dnah2 UTSW 11 69493261 missense possibly damaging 0.73
R8804:Dnah2 UTSW 11 69465685 missense probably benign 0.01
R8876:Dnah2 UTSW 11 69491522 missense probably damaging 1.00
RF004:Dnah2 UTSW 11 69437187 missense probably benign 0.24
U24488:Dnah2 UTSW 11 69483822 missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69448562 missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69430793 missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69421821 missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69451120 missense probably benign
Z1176:Dnah2 UTSW 11 69487054 missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69498667 missense probably benign 0.12
Z1176:Dnah2 UTSW 11 69516481 missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69516523 missense probably damaging 1.00
Z1177:Dnah2 UTSW 11 69463453 missense possibly damaging 0.63
Z1177:Dnah2 UTSW 11 69544557 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CATCTTTCAACCTCACTGGGGC -3'
(R):5'- ATCGTTAGAGTGCGCAGTGG -3'

Sequencing Primer
(F):5'- GGGGCTTCCTGTTCCCAG -3'
(R):5'- AGTGGCCTAGCTGCAGGTG -3'
Posted On2015-10-08