Incidental Mutation 'R4628:Pex5'
ID 348945
Institutional Source Beutler Lab
Gene Symbol Pex5
Ensembl Gene ENSMUSG00000005069
Gene Name peroxisomal biogenesis factor 5
Synonyms ESTM1, peroxisome biogenesis factor 5, PTS1R, Pxr1
MMRRC Submission 041893-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4628 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 124396816-124415067 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124403120 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 286 (D286G)
Ref Sequence ENSEMBL: ENSMUSP00000108150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035861] [ENSMUST00000080557] [ENSMUST00000112530] [ENSMUST00000112531] [ENSMUST00000112532]
AlphaFold O09012
Predicted Effect probably benign
Transcript: ENSMUST00000035861
AA Change: D323G

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049132
Gene: ENSMUSG00000005069
AA Change: D323G

DomainStartEndE-ValueType
low complexity region 231 247 N/A INTRINSIC
TPR 371 404 2.66e0 SMART
low complexity region 443 454 N/A INTRINSIC
TPR 488 521 1.76e-5 SMART
TPR 522 555 1.49e-3 SMART
TPR 556 589 3.87e-2 SMART
low complexity region 622 633 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000080557
AA Change: D286G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079398
Gene: ENSMUSG00000005069
AA Change: D286G

DomainStartEndE-ValueType
TPR 334 367 2.66e0 SMART
low complexity region 406 417 N/A INTRINSIC
TPR 451 484 1.76e-5 SMART
TPR 485 518 1.49e-3 SMART
TPR 519 552 3.87e-2 SMART
low complexity region 585 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112530
AA Change: D316G

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108149
Gene: ENSMUSG00000005069
AA Change: D316G

DomainStartEndE-ValueType
low complexity region 224 240 N/A INTRINSIC
TPR 364 397 2.66e0 SMART
low complexity region 436 447 N/A INTRINSIC
TPR 481 514 1.76e-5 SMART
TPR 515 548 1.49e-3 SMART
TPR 549 582 3.87e-2 SMART
low complexity region 615 626 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112531
AA Change: D286G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108150
Gene: ENSMUSG00000005069
AA Change: D286G

DomainStartEndE-ValueType
TPR 334 367 2.66e0 SMART
low complexity region 406 417 N/A INTRINSIC
TPR 451 484 1.76e-5 SMART
TPR 485 518 1.49e-3 SMART
TPR 519 552 3.87e-2 SMART
low complexity region 585 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112532
AA Change: D323G

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108151
Gene: ENSMUSG00000005069
AA Change: D323G

DomainStartEndE-ValueType
low complexity region 231 247 N/A INTRINSIC
TPR 371 404 2.66e0 SMART
low complexity region 443 454 N/A INTRINSIC
TPR 488 521 1.76e-5 SMART
TPR 522 555 1.49e-3 SMART
TPR 556 589 3.87e-2 SMART
low complexity region 622 633 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156415
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene binds to the C-terminal PTS1-type tripeptide peroxisomal targeting signal (SKL-type) and plays an essential role in peroxisomal protein import. Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. The peroxisomal biogenesis disorders are a heterogeneous group with at least 14 complementation groups and with more than 1 phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause of neonatal adrenoleukodystrophy (NALD), a cause of Zellweger syndrome (ZWS) as well as may be a cause of infantile Refsum disease (IRD). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced size, muscle weakness, respiratory distress, and retarded development and defects of the kidney, liver, brain, and intestine associated with lack of peroxisomes, and die within 3-4 days of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik G C 5: 118,259,414 A154P probably damaging Het
Abca7 G T 10: 80,015,188 probably null Het
Abcb4 A G 5: 8,907,399 D176G probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
AF366264 T A 8: 13,836,625 R489W probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd12 T C 17: 65,985,994 T815A probably benign Het
Arid3a T C 10: 79,931,158 S89P possibly damaging Het
Ass1 A T 2: 31,480,988 D63V probably damaging Het
Atxn3 T A 12: 101,923,078 probably benign Het
Bcap29 C T 12: 31,626,807 S88N probably benign Het
Bsn G T 9: 108,113,235 P1773T probably damaging Het
Ccdc141 A G 2: 77,059,680 S423P probably benign Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chd8 T C 14: 52,206,915 R438G probably benign Het
Chd9 T A 8: 90,983,463 M289K probably benign Het
Col14a1 T A 15: 55,449,833 Y26* probably null Het
Colec10 A G 15: 54,459,731 T117A possibly damaging Het
Colq C A 14: 31,544,022 G178V probably damaging Het
Defb3 A T 8: 19,295,140 R37S probably benign Het
Duox1 A G 2: 122,346,252 Y1418C probably damaging Het
Engase C T 11: 118,484,905 S33F probably damaging Het
Erich3 A T 3: 154,763,687 T1259S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fhod3 T A 18: 25,120,129 F1379I possibly damaging Het
Fndc3b T C 3: 27,556,128 I86V probably benign Het
Gm1123 A G 9: 99,014,236 V197A probably damaging Het
Gm4847 A T 1: 166,630,395 V463E probably damaging Het
Gm9772 T C 17: 22,007,207 K32R probably damaging Het
Gm9804 T C 12: 49,401,757 S161P unknown Het
Gpr162 C T 6: 124,861,442 D82N probably benign Het
Grid2ip T C 5: 143,382,875 V650A probably damaging Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Hsd3b6 T G 3: 98,806,579 K135Q possibly damaging Het
Igfn1 T C 1: 135,959,730 D2532G possibly damaging Het
Iqgap2 A G 13: 95,763,329 Y74H probably benign Het
Itga2 A G 13: 114,877,693 V233A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lcmt1 T A 7: 123,410,812 C183* probably null Het
Lcn5 A G 2: 25,658,063 E28G possibly damaging Het
Leo1 A T 9: 75,445,697 D174V probably damaging Het
Llgl1 A T 11: 60,709,985 T636S probably damaging Het
Lrrc8e T A 8: 4,233,981 C69S probably damaging Het
Maml3 A T 3: 51,796,470 probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mrpl24 A C 3: 87,922,129 probably null Het
Myo18a G A 11: 77,824,136 V834M probably damaging Het
Neb T A 2: 52,308,350 R461* probably null Het
Notch4 C A 17: 34,570,185 T486N probably damaging Het
Nphp3 A G 9: 104,003,058 E93G probably damaging Het
Nup188 A G 2: 30,329,346 Y858C probably damaging Het
Olfr339 T A 2: 36,421,857 L153* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr61 C T 7: 140,638,384 R228C probably benign Het
Otud4 T A 8: 79,639,968 D21E possibly damaging Het
Ovgp1 T A 3: 105,980,323 probably null Het
Pdia3 A T 2: 121,414,139 N11I possibly damaging Het
Pias3 T C 3: 96,699,820 I133T probably damaging Het
Postn A G 3: 54,372,157 D352G probably damaging Het
Prl7c1 T C 13: 27,778,082 R81G probably benign Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rtraf T A 14: 19,817,087 N116I probably benign Het
Slc6a12 T A 6: 121,351,992 C50* probably null Het
Srcin1 T A 11: 97,548,926 H126L probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Uroc1 A T 6: 90,355,328 I556F probably damaging Het
Vmn1r124 T A 7: 21,260,377 K81* probably null Het
Vmn1r57 T A 7: 5,220,973 C166S probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r68 A G 7: 85,234,465 V144A probably benign Het
Vmn2r85 C T 10: 130,425,366 M367I probably benign Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfhx4 G A 3: 5,403,476 R2898H probably damaging Het
Other mutations in Pex5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Pex5 APN 6 124398380 missense probably damaging 1.00
IGL02027:Pex5 APN 6 124398888 missense probably benign 0.20
IGL02041:Pex5 APN 6 124405281 splice site probably benign
IGL02128:Pex5 APN 6 124398460 missense probably damaging 1.00
IGL02507:Pex5 APN 6 124413305 missense probably benign
IGL02539:Pex5 APN 6 124403224 missense probably benign 0.02
IGL03180:Pex5 APN 6 124413563 splice site probably benign
G1Funyon:Pex5 UTSW 6 124405183 missense probably benign 0.02
R0143:Pex5 UTSW 6 124398489 missense probably damaging 1.00
R0600:Pex5 UTSW 6 124404637 missense probably benign 0.10
R0904:Pex5 UTSW 6 124399937 splice site probably benign
R1970:Pex5 UTSW 6 124414405 missense probably damaging 1.00
R4879:Pex5 UTSW 6 124398363 missense probably benign 0.02
R5068:Pex5 UTSW 6 124413596 missense probably benign 0.01
R5069:Pex5 UTSW 6 124413596 missense probably benign 0.01
R5339:Pex5 UTSW 6 124398004 missense probably benign 0.02
R6433:Pex5 UTSW 6 124413613 missense possibly damaging 0.81
R6825:Pex5 UTSW 6 124414381 missense probably damaging 0.98
R6851:Pex5 UTSW 6 124403154 missense possibly damaging 0.92
R7148:Pex5 UTSW 6 124405272 missense probably benign 0.10
R7286:Pex5 UTSW 6 124398063 nonsense probably null
R7673:Pex5 UTSW 6 124399383 missense probably damaging 0.98
R7752:Pex5 UTSW 6 124403901 missense probably damaging 0.99
R7752:Pex5 UTSW 6 124414018 missense probably benign 0.03
R7793:Pex5 UTSW 6 124399341 missense probably benign 0.00
R8301:Pex5 UTSW 6 124405183 missense probably benign 0.02
R8964:Pex5 UTSW 6 124398781 missense probably benign 0.00
Z1177:Pex5 UTSW 6 124398386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGTGGGCATTATGTCACTG -3'
(R):5'- CTGAAGTTTGCAGCTCATTGTTC -3'

Sequencing Primer
(F):5'- ATGTCACTGTGTGATCTGAAAAGG -3'
(R):5'- GTTCTAACAATTATATCCCTGTGGG -3'
Posted On 2015-10-08