Incidental Mutation 'R4628:Top2b'
ID348989
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Nametopoisomerase (DNA) II beta
SynonymsD230016L12Rik, Top-2
MMRRC Submission 041893-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock #R4628 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location16365179-16435462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 16409189 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 777 (I777M)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
Predicted Effect probably damaging
Transcript: ENSMUST00000017629
AA Change: I777M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: I777M

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159302
SMART Domains Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 1 177 4.06e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160501
SMART Domains Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 2 222 3.97e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161693
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Meta Mutation Damage Score 0.8018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik G C 5: 118,259,414 A154P probably damaging Het
Abca7 G T 10: 80,015,188 probably null Het
Abcb4 A G 5: 8,907,399 D176G probably benign Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
AF366264 T A 8: 13,836,625 R489W probably damaging Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd12 T C 17: 65,985,994 T815A probably benign Het
Arid3a T C 10: 79,931,158 S89P possibly damaging Het
Ass1 A T 2: 31,480,988 D63V probably damaging Het
Atxn3 T A 12: 101,923,078 probably benign Het
Bcap29 C T 12: 31,626,807 S88N probably benign Het
Bsn G T 9: 108,113,235 P1773T probably damaging Het
Ccdc141 A G 2: 77,059,680 S423P probably benign Het
Cfap46 A T 7: 139,680,927 L85Q probably damaging Het
Chd8 T C 14: 52,206,915 R438G probably benign Het
Chd9 T A 8: 90,983,463 M289K probably benign Het
Col14a1 T A 15: 55,449,833 Y26* probably null Het
Colec10 A G 15: 54,459,731 T117A possibly damaging Het
Colq C A 14: 31,544,022 G178V probably damaging Het
Defb3 A T 8: 19,295,140 R37S probably benign Het
Duox1 A G 2: 122,346,252 Y1418C probably damaging Het
Engase C T 11: 118,484,905 S33F probably damaging Het
Erich3 A T 3: 154,763,687 T1259S probably damaging Het
Fam98c T C 7: 29,155,268 T49A possibly damaging Het
Fhod3 T A 18: 25,120,129 F1379I possibly damaging Het
Fndc3b T C 3: 27,556,128 I86V probably benign Het
Gm1123 A G 9: 99,014,236 V197A probably damaging Het
Gm4847 A T 1: 166,630,395 V463E probably damaging Het
Gm9772 T C 17: 22,007,207 K32R probably damaging Het
Gm9804 T C 12: 49,401,757 S161P unknown Het
Gpr162 C T 6: 124,861,442 D82N probably benign Het
Grid2ip T C 5: 143,382,875 V650A probably damaging Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Hsd3b6 T G 3: 98,806,579 K135Q possibly damaging Het
Igfn1 T C 1: 135,959,730 D2532G possibly damaging Het
Iqgap2 A G 13: 95,763,329 Y74H probably benign Het
Itga2 A G 13: 114,877,693 V233A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lcmt1 T A 7: 123,410,812 C183* probably null Het
Lcn5 A G 2: 25,658,063 E28G possibly damaging Het
Leo1 A T 9: 75,445,697 D174V probably damaging Het
Llgl1 A T 11: 60,709,985 T636S probably damaging Het
Lrrc8e T A 8: 4,233,981 C69S probably damaging Het
Maml3 A T 3: 51,796,470 probably benign Het
Maz G T 7: 127,025,347 H334N possibly damaging Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mrpl24 A C 3: 87,922,129 probably null Het
Myo18a G A 11: 77,824,136 V834M probably damaging Het
Neb T A 2: 52,308,350 R461* probably null Het
Notch4 C A 17: 34,570,185 T486N probably damaging Het
Nphp3 A G 9: 104,003,058 E93G probably damaging Het
Nup188 A G 2: 30,329,346 Y858C probably damaging Het
Olfr339 T A 2: 36,421,857 L153* probably null Het
Olfr45 T A 7: 140,691,378 S158T probably benign Het
Olfr61 C T 7: 140,638,384 R228C probably benign Het
Otud4 T A 8: 79,639,968 D21E possibly damaging Het
Ovgp1 T A 3: 105,980,323 probably null Het
Pdia3 A T 2: 121,414,139 N11I possibly damaging Het
Pex5 T C 6: 124,403,120 D286G possibly damaging Het
Pias3 T C 3: 96,699,820 I133T probably damaging Het
Postn A G 3: 54,372,157 D352G probably damaging Het
Prl7c1 T C 13: 27,778,082 R81G probably benign Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rtraf T A 14: 19,817,087 N116I probably benign Het
Slc6a12 T A 6: 121,351,992 C50* probably null Het
Srcin1 T A 11: 97,548,926 H126L probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Uroc1 A T 6: 90,355,328 I556F probably damaging Het
Vmn1r124 T A 7: 21,260,377 K81* probably null Het
Vmn1r57 T A 7: 5,220,973 C166S probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r68 A G 7: 85,234,465 V144A probably benign Het
Vmn2r85 C T 10: 130,425,366 M367I probably benign Het
Vwa3a T A 7: 120,793,375 N812K probably benign Het
Wdfy4 A T 14: 33,102,558 N1301K probably damaging Het
Zfhx4 G A 3: 5,403,476 R2898H probably damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
X0028:Top2b UTSW 14 16384499 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACTGAAGATGGGATCAACTG -3'
(R):5'- TGAAGTACTCTCCCTGAGCAG -3'

Sequencing Primer
(F):5'- CTGAAGATGGGATCAACTGAGAACTG -3'
(R):5'- TCTCCCTGAGCAGAAAAACTAAATG -3'
Posted On2015-10-08