Incidental Mutation 'R0266:Rag2'
ID34903
Institutional Source Beutler Lab
Gene Symbol Rag2
Ensembl Gene ENSMUSG00000032864
Gene Namerecombination activating gene 2
SynonymsRag-2
MMRRC Submission 038492-MU
Accession Numbers

MGI:97849

Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R0266 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location101624718-101632529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101630603 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 419 (C419W)
Ref Sequence ENSEMBL: ENSMUSP00000106858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044031] [ENSMUST00000099682] [ENSMUST00000111227] [ENSMUST00000111231] [ENSMUST00000128898] [ENSMUST00000160037] [ENSMUST00000160722]
Predicted Effect probably damaging
Transcript: ENSMUST00000044031
AA Change: C419W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038204
Gene: ENSMUSG00000032864
AA Change: C419W

DomainStartEndE-ValueType
Pfam:RAG2 51 389 3.5e-179 PFAM
Pfam:RAG2_PHD 414 491 7.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099682
Predicted Effect probably damaging
Transcript: ENSMUST00000111227
AA Change: C419W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106858
Gene: ENSMUSG00000032864
AA Change: C419W

DomainStartEndE-ValueType
Pfam:RAG2 51 389 6.7e-193 PFAM
Pfam:RAG2_PHD 414 491 1.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111231
Predicted Effect probably benign
Transcript: ENSMUST00000128898
Predicted Effect probably benign
Transcript: ENSMUST00000160037
Predicted Effect probably benign
Transcript: ENSMUST00000160722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177171
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in the initiation of V(D)J recombination during B and T cell development. This protein forms a complex with the product of the adjacent recombination activating gene 1, and this complex can form double-strand breaks by cleaving DNA at conserved recombination signal sequences. The recombination activating gene 1 component is thought to contain most of the catalytic activity, while the N-terminal of the recombination activating gene 2 component is thought to form a six-bladed propeller in the active core that serves as a binding scaffold for the tight association of the complex with DNA. A C-terminal plant homeodomain finger-like motif in this protein is necessary for interactions with chromatin components, specifically with histone H3 that is trimethylated at lysine 4. Mutations in this gene cause Omenn syndrome, a form of severe combined immunodeficiency associated with autoimmune-like symptoms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted(14)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A G 12: 110,668,754 S117P possibly damaging Het
Aars2 T C 17: 45,507,510 probably benign Het
Acot11 T C 4: 106,749,988 D466G probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Apbb2 A T 5: 66,302,611 N714K probably benign Het
Aqp12 C A 1: 93,006,850 H150N possibly damaging Het
Brinp3 T A 1: 146,682,680 L114* probably null Het
Ccng2 T C 5: 93,271,289 probably benign Het
Cd36 T A 5: 17,798,252 R265S probably benign Het
Ces4a T C 8: 105,141,966 L104S probably benign Het
Clca4b T C 3: 144,922,786 I387V probably damaging Het
Cul7 T A 17: 46,654,595 H566Q probably benign Het
Ddx60 A T 8: 62,033,493 H1646L possibly damaging Het
Dntt T C 19: 41,059,127 I503T probably damaging Het
Dynlt1a T G 17: 6,317,395 E2D probably benign Het
Efemp2 G T 19: 5,477,999 C78F probably damaging Het
Esco1 T C 18: 10,594,605 E227G probably benign Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm17541 A T 12: 4,689,487 probably benign Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm4782 T G 6: 50,610,694 S686R probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Grm8 T C 6: 27,285,896 Y839C probably damaging Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hes6 A T 1: 91,412,304 D143E possibly damaging Het
Hmcn2 A G 2: 31,394,827 E2055G probably benign Het
Hmcn2 G A 2: 31,445,353 probably benign Het
Ikzf3 A G 11: 98,467,317 L398P probably benign Het
Il10ra A T 9: 45,265,652 I125N probably benign Het
Kcnb2 G A 1: 15,712,913 probably benign Het
Krt77 T C 15: 101,869,378 R81G possibly damaging Het
Lrrc40 T A 3: 158,041,661 probably null Het
Man1a2 C T 3: 100,582,034 R543Q probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mettl14 A T 3: 123,382,826 S58T probably benign Het
Mrpl4 T C 9: 21,003,314 V62A probably benign Het
Myh3 A G 11: 67,093,672 D1085G possibly damaging Het
Myo5c C A 9: 75,284,216 probably benign Het
Naalad2 G T 9: 18,350,943 probably benign Het
Nat3 A G 8: 67,547,780 T104A probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfm1 A G 2: 28,229,607 Y403C probably damaging Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr873 A T 9: 20,301,158 R320S probably benign Het
Osbpl1a T A 18: 12,871,163 probably null Het
Pax7 G A 4: 139,779,736 S330L possibly damaging Het
Pcdhb15 C A 18: 37,475,276 D520E probably damaging Het
Pgm3 T C 9: 86,567,533 T145A probably benign Het
Phox2b G A 5: 67,096,625 probably null Het
Pik3r6 A T 11: 68,526,408 R59* probably null Het
Pold1 A G 7: 44,541,025 probably benign Het
Ppp1r21 T C 17: 88,569,072 probably benign Het
Prl5a1 A G 13: 28,149,987 K158E possibly damaging Het
Reln A G 5: 21,988,776 S1395P probably damaging Het
Retnlb T G 16: 48,818,659 Y74* probably null Het
Robo3 A G 9: 37,422,640 S633P probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Slc6a5 C A 7: 49,938,408 probably benign Het
Sort1 T A 3: 108,344,931 N481K probably benign Het
Sptlc3 T A 2: 139,596,037 I417K possibly damaging Het
Svil T A 18: 5,099,063 probably benign Het
Taf4b T C 18: 14,813,077 probably benign Het
Tchp T C 5: 114,709,333 M71T possibly damaging Het
Thsd4 T A 9: 59,997,134 H233L probably benign Het
Tmem217 G T 17: 29,526,599 N52K possibly damaging Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Uqcrfs1 A C 13: 30,541,163 N131K probably benign Het
Vars T A 17: 35,013,869 S896R probably benign Het
Vmn1r170 A T 7: 23,606,481 M103L probably benign Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Wdr49 A T 3: 75,451,796 I8N possibly damaging Het
Zfp648 T A 1: 154,204,886 Y264N probably damaging Het
Zmym1 A C 4: 127,048,025 F857V possibly damaging Het
Other mutations in Rag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Rag2 APN 2 101630617 missense probably benign 0.00
IGL01358:Rag2 APN 2 101630020 missense possibly damaging 0.95
IGL01774:Rag2 APN 2 101630047 missense probably damaging 1.00
IGL02267:Rag2 APN 2 101630031 missense probably damaging 1.00
IGL02507:Rag2 APN 2 101630710 missense probably damaging 0.99
IGL02615:Rag2 APN 2 101629568 nonsense probably null
IGL02690:Rag2 APN 2 101629494 missense probably benign 0.00
IGL03087:Rag2 APN 2 101630214 missense probably benign 0.00
IGL03261:Rag2 APN 2 101630263 missense probably damaging 0.96
snowcock UTSW 2 101630603 missense probably damaging 1.00
woodcock UTSW 2 101630119 missense probably damaging 0.98
R0284:Rag2 UTSW 2 101630119 missense probably damaging 0.98
R1250:Rag2 UTSW 2 101630439 missense probably damaging 0.96
R1520:Rag2 UTSW 2 101630131 missense probably damaging 0.99
R1641:Rag2 UTSW 2 101629615 missense probably benign 0.22
R2260:Rag2 UTSW 2 101630238 missense probably benign 0.00
R2571:Rag2 UTSW 2 101629967 missense probably damaging 0.99
R3441:Rag2 UTSW 2 101630300 missense probably damaging 0.99
R3752:Rag2 UTSW 2 101630776 missense probably damaging 0.99
R4894:Rag2 UTSW 2 101629677 missense probably damaging 1.00
R5197:Rag2 UTSW 2 101630740 missense probably damaging 1.00
R5236:Rag2 UTSW 2 101629660 missense probably damaging 1.00
R6815:Rag2 UTSW 2 101630555 missense probably damaging 0.99
R7365:Rag2 UTSW 2 101630773 missense probably damaging 1.00
X0027:Rag2 UTSW 2 101630373 missense probably damaging 1.00
Z31818:Rag2 UTSW 2 101630805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGGAATCTCTGTCTCCAGTGC -3'
(R):5'- AGGAGTCAAGACTTTCCCAGAGCC -3'

Posted On2013-05-09