Incidental Mutation 'R4629:Zfp87'
ID 349070
Institutional Source Beutler Lab
Gene Symbol Zfp87
Ensembl Gene ENSMUSG00000097333
Gene Name zinc finger protein 87
Synonyms Mzf22, 2210039O17Rik, 4631412O18Rik, Zfp72, KRAB4
MMRRC Submission 041894-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R4629 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 67663900-67674296 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74520512 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 189 (C189R)
Ref Sequence ENSEMBL: ENSMUSP00000152502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091481] [ENSMUST00000223163]
AlphaFold Q8K2A4
Predicted Effect probably damaging
Transcript: ENSMUST00000091481
AA Change: C189R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089063
Gene: ENSMUSG00000069184
AA Change: C189R

DomainStartEndE-ValueType
KRAB 1 32 3.57e-1 SMART
ZnF_C2H2 48 70 5.42e-2 SMART
ZnF_C2H2 76 98 1.18e-2 SMART
ZnF_C2H2 104 126 2.05e-2 SMART
ZnF_C2H2 132 154 2.3e-5 SMART
ZnF_C2H2 160 181 2.45e0 SMART
ZnF_C2H2 187 209 1.92e-2 SMART
ZnF_C2H2 215 237 5.59e-4 SMART
ZnF_C2H2 243 265 4.87e-4 SMART
ZnF_C2H2 271 293 4.94e-5 SMART
ZnF_C2H2 299 321 9.08e-4 SMART
ZnF_C2H2 327 349 1.13e-4 SMART
ZnF_C2H2 355 377 3.16e-3 SMART
ZnF_C2H2 383 405 2.24e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223163
AA Change: C189R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,108,419 (GRCm39) noncoding transcript Het
Abca6 T C 11: 110,121,375 (GRCm39) probably null Het
Adam22 A G 5: 8,282,663 (GRCm39) S111P possibly damaging Het
Adamts18 C T 8: 114,499,800 (GRCm39) W371* probably null Het
Akr1c13 G T 13: 4,247,869 (GRCm39) V214F probably damaging Het
Alg10b C T 15: 90,111,948 (GRCm39) A264V probably benign Het
Angpt1 T A 15: 42,301,796 (GRCm39) Y404F probably benign Het
Apol7c A G 15: 77,410,595 (GRCm39) F117S probably damaging Het
Asic5 T A 3: 81,913,811 (GRCm39) Y162N probably damaging Het
Cacna2d2 A T 9: 107,404,521 (GRCm39) E1104V probably damaging Het
Cad G A 5: 31,227,639 (GRCm39) V1263I probably damaging Het
Cdc20 T C 4: 118,290,761 (GRCm39) E413G probably damaging Het
Cfap46 A T 7: 139,260,843 (GRCm39) L85Q probably damaging Het
Cnot6l A G 5: 96,225,070 (GRCm39) V541A probably benign Het
Cubn T A 2: 13,318,790 (GRCm39) probably null Het
Cx3cr1 T C 9: 119,880,730 (GRCm39) N224S probably damaging Het
Fam98c T C 7: 28,854,693 (GRCm39) T49A possibly damaging Het
Fez2 C T 17: 78,710,183 (GRCm39) S202N probably benign Het
Fras1 A G 5: 96,924,593 (GRCm39) N3678S probably benign Het
Glyr1 A G 16: 4,854,907 (GRCm39) V57A possibly damaging Het
Gm5617 T A 9: 48,407,187 (GRCm39) L107Q possibly damaging Het
Gpnmb A G 6: 49,027,994 (GRCm39) D401G possibly damaging Het
Gtpbp6 C A 5: 110,254,774 (GRCm39) V100L possibly damaging Het
Gucy1a1 A G 3: 82,004,931 (GRCm39) V618A probably damaging Het
H6pd A T 4: 150,080,803 (GRCm39) M14K probably benign Het
Hectd4 A G 5: 121,435,266 (GRCm39) M993V probably benign Het
Kat14 A G 2: 144,246,140 (GRCm39) probably benign Het
Kctd21 A G 7: 96,996,782 (GRCm39) D85G probably damaging Het
Kera A G 10: 97,445,493 (GRCm39) N284S probably benign Het
Krt1 C T 15: 101,754,622 (GRCm39) G543S unknown Het
Lama1 A G 17: 68,112,355 (GRCm39) probably null Het
Lgr6 T C 1: 135,032,670 (GRCm39) Y70C probably damaging Het
Lipg T A 18: 75,081,107 (GRCm39) K325* probably null Het
Lrrc43 T C 5: 123,637,583 (GRCm39) L250P probably damaging Het
Lyz1 C T 10: 117,127,041 (GRCm39) R65H probably benign Het
Marchf10 T A 11: 105,280,664 (GRCm39) L540F probably benign Het
Maz G T 7: 126,624,519 (GRCm39) H334N possibly damaging Het
Myh1 A G 11: 67,100,119 (GRCm39) K646R probably benign Het
Nf2 A T 11: 4,798,915 (GRCm39) V24E probably damaging Het
Nup210l T C 3: 90,075,182 (GRCm39) S831P probably benign Het
Nup210l C T 3: 90,098,181 (GRCm39) R1378* probably null Het
Or13a17 T A 7: 140,271,291 (GRCm39) S158T probably benign Het
Orc5 G T 5: 22,753,003 (GRCm39) F10L probably benign Het
Palb2 A C 7: 121,727,189 (GRCm39) I227S possibly damaging Het
Pate3 A T 9: 35,557,453 (GRCm39) C68S probably damaging Het
Pcdha12 T A 18: 37,154,926 (GRCm39) N548K probably damaging Het
Prdm10 C T 9: 31,248,612 (GRCm39) Q345* probably null Het
Ptx4 A T 17: 25,341,737 (GRCm39) N71Y probably damaging Het
Rab42 C T 4: 132,030,548 (GRCm39) R34Q probably benign Het
Rergl A G 6: 139,478,850 (GRCm39) V8A probably damaging Het
Rmi1 A G 13: 58,556,950 (GRCm39) R400G probably benign Het
Rpia A G 6: 70,743,578 (GRCm39) M291T possibly damaging Het
Rplp0 G A 5: 115,699,482 (GRCm39) probably null Het
Rrp12 A T 19: 41,871,955 (GRCm39) I443N probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Saxo1 T C 4: 86,406,064 (GRCm39) Y45C probably damaging Het
Sec24a A T 11: 51,612,640 (GRCm39) probably null Het
Setdb2 A G 14: 59,646,808 (GRCm39) V585A probably benign Het
Sik1 T C 17: 32,068,581 (GRCm39) E347G probably benign Het
Srbd1 T C 17: 86,428,100 (GRCm39) T378A probably damaging Het
Tacr1 A G 6: 82,380,861 (GRCm39) T91A probably benign Het
Tas2r135 T A 6: 42,383,160 (GRCm39) M233K probably benign Het
Tfg A T 16: 56,533,039 (GRCm39) M40K probably damaging Het
Tmem35b C T 4: 127,022,796 (GRCm39) P133S probably benign Het
Tmtc2 A T 10: 105,139,511 (GRCm39) S672T probably benign Het
Trpv3 A T 11: 73,172,615 (GRCm39) K253N probably damaging Het
Ube2c A G 2: 164,614,093 (GRCm39) N143S possibly damaging Het
Unc13a A G 8: 72,106,097 (GRCm39) M669T possibly damaging Het
Vmn1r61 T A 7: 5,614,249 (GRCm39) I22F probably benign Het
Vmn2r26 A T 6: 124,038,150 (GRCm39) Q575L possibly damaging Het
Vmn2r81 A T 10: 79,103,276 (GRCm39) E156D probably damaging Het
Vwa3a T A 7: 120,392,598 (GRCm39) N812K probably benign Het
Wasl T C 6: 24,637,680 (GRCm39) R71G probably damaging Het
Wdfy4 A T 14: 32,824,515 (GRCm39) N1301K probably damaging Het
Zfp827 G A 8: 79,787,011 (GRCm39) R59Q probably damaging Het
Other mutations in Zfp87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Zfp87 APN 13 67,665,989 (GRCm39) missense probably damaging 0.99
IGL02372:Zfp87 APN 13 67,668,739 (GRCm39) splice site probably benign
IGL03160:Zfp87 APN 13 67,669,392 (GRCm39) missense probably damaging 1.00
R0653:Zfp87 UTSW 13 74,520,190 (GRCm39) missense probably damaging 1.00
R0711:Zfp87 UTSW 13 74,524,544 (GRCm39) splice site probably benign
R1498:Zfp87 UTSW 13 74,520,736 (GRCm39) missense probably benign 0.01
R3801:Zfp87 UTSW 13 67,669,334 (GRCm39) missense probably damaging 1.00
R4032:Zfp87 UTSW 13 74,520,449 (GRCm39) missense possibly damaging 0.62
R4950:Zfp87 UTSW 13 67,666,018 (GRCm39) missense probably benign 0.20
R5604:Zfp87 UTSW 13 67,665,945 (GRCm39) missense probably damaging 1.00
R6111:Zfp87 UTSW 13 74,520,504 (GRCm39) missense probably benign 0.31
R6130:Zfp87 UTSW 13 74,520,460 (GRCm39) missense possibly damaging 0.75
R6277:Zfp87 UTSW 13 74,520,643 (GRCm39) nonsense probably null
R6392:Zfp87 UTSW 13 67,664,986 (GRCm39) missense probably benign 0.00
R6800:Zfp87 UTSW 13 74,520,080 (GRCm39) missense probably benign 0.00
R6909:Zfp87 UTSW 13 74,519,861 (GRCm39) missense possibly damaging 0.47
R7009:Zfp87 UTSW 13 67,665,173 (GRCm39) missense probably damaging 1.00
R7183:Zfp87 UTSW 13 67,665,593 (GRCm39) missense probably damaging 1.00
R7298:Zfp87 UTSW 13 74,520,513 (GRCm39) missense possibly damaging 0.93
R7330:Zfp87 UTSW 13 74,523,153 (GRCm39) missense probably damaging 0.99
R7341:Zfp87 UTSW 13 74,520,467 (GRCm39) missense possibly damaging 0.68
R7448:Zfp87 UTSW 13 67,665,163 (GRCm39) missense probably benign 0.01
R7597:Zfp87 UTSW 13 67,665,412 (GRCm39) missense probably benign 0.06
R8696:Zfp87 UTSW 13 74,520,599 (GRCm39) missense probably damaging 1.00
R9280:Zfp87 UTSW 13 74,520,803 (GRCm39) missense probably benign 0.16
R9429:Zfp87 UTSW 13 74,520,703 (GRCm39) missense probably damaging 1.00
R9780:Zfp87 UTSW 13 67,665,241 (GRCm39) missense probably damaging 1.00
R9782:Zfp87 UTSW 13 74,520,932 (GRCm39) missense probably benign 0.00
RF014:Zfp87 UTSW 13 74,523,173 (GRCm39) missense probably benign 0.17
Z1176:Zfp87 UTSW 13 67,674,275 (GRCm39) start gained probably benign
Z1177:Zfp87 UTSW 13 74,519,911 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCACTCATAAGGTTTCTCTCCA -3'
(R):5'- AACCCTACAAATGTGAACAGTGT -3'

Sequencing Primer
(F):5'- CCACATTCGCTGCATTTGTAGGG -3'
(R):5'- CATCAGAGAATTCACACTGGTG -3'
Posted On 2015-10-08