Mutagenetix > Incidental Mutation

Incidental Mutation 'R4629:Setdb2'

349072

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

041894-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R4629 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59409359 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 585 (V585A)

Ref Sequence

ENSEMBL: ENSMUSP00000093450 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

probably benign
Transcript: ENSMUST00000095775
AA Change: V585A

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: V585A

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159640

Predicted Effect

probably benign
Transcript: ENSMUST00000161459
AA Change: V569A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: V569A

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161959

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921528I07Rik	T	C	9: 114,279,351		noncoding transcript	Het
Abca6	T	C	11: 110,230,549		probably null	Het
Adam22	A	G	5: 8,232,663	S111P	possibly damaging	Het
Adamts18	C	T	8: 113,773,168	W371*	probably null	Het
Akr1c13	G	T	13: 4,197,870	V214F	probably damaging	Het
Alg10b	C	T	15: 90,227,745	A264V	probably benign	Het
Angpt1	T	A	15: 42,438,400	Y404F	probably benign	Het
Apol7c	A	G	15: 77,526,395	F117S	probably damaging	Het
Asic5	T	A	3: 82,006,504	Y162N	probably damaging	Het
Cacna2d2	A	T	9: 107,527,322	E1104V	probably damaging	Het
Cad	G	A	5: 31,070,295	V1263I	probably damaging	Het
Cdc20	T	C	4: 118,433,564	E413G	probably damaging	Het
Cfap46	A	T	7: 139,680,927	L85Q	probably damaging	Het
Cnot6l	A	G	5: 96,077,211	V541A	probably benign	Het
Cubn	T	A	2: 13,313,979		probably null	Het
Cx3cr1	T	C	9: 120,051,664	N224S	probably damaging	Het
Fam98c	T	C	7: 29,155,268	T49A	possibly damaging	Het
Fez2	C	T	17: 78,402,754	S202N	probably benign	Het
Fras1	A	G	5: 96,776,734	N3678S	probably benign	Het
Glyr1	A	G	16: 5,037,043	V57A	possibly damaging	Het
Gm5617	T	A	9: 48,495,887	L107Q	possibly damaging	Het
Gpnmb	A	G	6: 49,051,060	D401G	possibly damaging	Het
Gtpbp6	C	A	5: 110,106,908	V100L	possibly damaging	Het
Gucy1a1	A	G	3: 82,097,624	V618A	probably damaging	Het
H6pd	A	T	4: 149,996,346	M14K	probably benign	Het
Hectd4	A	G	5: 121,297,203	M993V	probably benign	Het
Kat14	A	G	2: 144,404,220		probably benign	Het
Kctd21	A	G	7: 97,347,575	D85G	probably damaging	Het
Kera	A	G	10: 97,609,631	N284S	probably benign	Het
Krt1	C	T	15: 101,846,187	G543S	unknown	Het
Lama1	A	G	17: 67,805,360		probably null	Het
Lgr6	T	C	1: 135,104,932	Y70C	probably damaging	Het
Lipg	T	A	18: 74,948,036	K325*	probably null	Het
Lrrc43	T	C	5: 123,499,520	L250P	probably damaging	Het
Lyz1	C	T	10: 117,291,136	R65H	probably benign	Het
March10	T	A	11: 105,389,838	L540F	probably benign	Het
Maz	G	T	7: 127,025,347	H334N	possibly damaging	Het
Myh1	A	G	11: 67,209,293	K646R	probably benign	Het
Nf2	A	T	11: 4,848,915	V24E	probably damaging	Het
Nup210l	T	C	3: 90,167,875	S831P	probably benign	Het
Nup210l	C	T	3: 90,190,874	R1378*	probably null	Het
Olfr45	T	A	7: 140,691,378	S158T	probably benign	Het
Orc5	G	T	5: 22,548,005	F10L	probably benign	Het
Palb2	A	C	7: 122,127,966	I227S	possibly damaging	Het
Pate3	A	T	9: 35,646,157	C68S	probably damaging	Het
Pcdha12	T	A	18: 37,021,873	N548K	probably damaging	Het
Prdm10	C	T	9: 31,337,316	Q345*	probably null	Het
Ptx4	A	T	17: 25,122,763	N71Y	probably damaging	Het
Rab42	C	T	4: 132,303,237	R34Q	probably benign	Het
Rergl	A	G	6: 139,501,852	V8A	probably damaging	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Rpia	A	G	6: 70,766,594	M291T	possibly damaging	Het
Rplp0	G	A	5: 115,561,423		probably null	Het
Rrp12	A	T	19: 41,883,516	I443N	probably benign	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Saxo1	T	C	4: 86,487,827	Y45C	probably damaging	Het
Sec24a	A	T	11: 51,721,813		probably null	Het
Sik1	T	C	17: 31,849,607	E347G	probably benign	Het
Srbd1	T	C	17: 86,120,672	T378A	probably damaging	Het
Tacr1	A	G	6: 82,403,880	T91A	probably benign	Het
Tas2r135	T	A	6: 42,406,226	M233K	probably benign	Het
Tfg	A	T	16: 56,712,676	M40K	probably damaging	Het
Tmem35b	C	T	4: 127,129,003	P133S	probably benign	Het
Tmtc2	A	T	10: 105,303,650	S672T	probably benign	Het
Trpv3	A	T	11: 73,281,789	K253N	probably damaging	Het
Ube2c	A	G	2: 164,772,173	N143S	possibly damaging	Het
Unc13a	A	G	8: 71,653,453	M669T	possibly damaging	Het
Vmn1r61	T	A	7: 5,611,250	I22F	probably benign	Het
Vmn2r26	A	T	6: 124,061,191	Q575L	possibly damaging	Het
Vmn2r81	A	T	10: 79,267,442	E156D	probably damaging	Het
Vwa3a	T	A	7: 120,793,375	N812K	probably benign	Het
Wasl	T	C	6: 24,637,681	R71G	probably damaging	Het
Wdfy4	A	T	14: 33,102,558	N1301K	probably damaging	Het
Zfp72	A	G	13: 74,372,393	C189R	probably damaging	Het
Zfp827	G	A	8: 79,060,382	R59Q	probably damaging	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGGAAACGGCCCACATTTC -3'
(R):5'- GTCATCTCACTTAATCTTAGCACTG -3'

Sequencing Primer
(F):5'- AAACGGCCCACATTTCCTTCTTTTG -3'
(R):5'- CCTTCCTAACAATGTCTACTAGAGG -3'

Posted On

2015-10-08