Mutagenetix > Incidental Mutations

Incidental Mutation 'R4630:Pik3r4'

349124

Institutional Source

Beutler Lab

Gene Symbol

Pik3r4

Ensembl Gene

ENSMUSG00000032571

Gene Name

phosphoinositide-3-kinase regulatory subunit 4

Synonyms

D9Ertd418e, 2210010O15Rik, C730038E05Rik

MMRRC Submission

041895-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4630 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105642978-105687657 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105654899 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 557 (M557V)

Ref Sequence

ENSEMBL: ENSMUSP00000139427 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065778] [ENSMUST00000186943] [ENSMUST00000191268]

Predicted Effect

probably benign
Transcript: ENSMUST00000065778
AA Change: M557V

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000067400
Gene: ENSMUSG00000032571
AA Change: M557V

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	26	310	1.7e-5	PFAM
Pfam:Pkinase	26	312	1.2e-18	PFAM
coiled coil region	941	963	N/A	INTRINSIC
WD40	982	1021	3.99e-8	SMART
WD40	1031	1070	6.16e0	SMART
WD40	1132	1169	4.58e1	SMART
WD40	1171	1214	1.64e2	SMART
WD40	1228	1269	2.76e-2	SMART
WD40	1317	1358	2.96e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191117

Predicted Effect

probably benign
Transcript: ENSMUST00000191268
AA Change: M557V

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571
AA Change: M557V

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	26	310	8.9e-7	PFAM
Pfam:Pkinase	26	312	3.7e-23	PFAM
coiled coil region	941	963	N/A	INTRINSIC
WD40	982	1021	3.99e-8	SMART
WD40	1031	1070	6.16e0	SMART
WD40	1132	1169	4.58e1	SMART
WD40	1171	1214	1.64e2	SMART
WD40	1228	1269	2.76e-2	SMART
WD40	1317	1358	2.96e-2	SMART

Meta Mutation Damage Score

0.0702

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

97% (74/76)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit earl embryonic lethality before E7.5. Mice homozygous for a conditional allele activated in muscles exhibit symptoms of autophagic vacuolar myopathies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,068,092	S393P	probably benign	Het
3110001I22Rik	T	C	16: 13,677,414	S126P	probably damaging	Het
3110070M22Rik	A	T	13: 119,488,086		probably benign	Het
4833423E24Rik	C	A	2: 85,518,646	G41*	probably null	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
BC024139	T	G	15: 76,125,094	Q240P	probably benign	Het
Bckdha	A	T	7: 25,631,459	I44N	probably damaging	Het
Brpf1	T	C	6: 113,309,906	Y32H	probably damaging	Het
Catip	A	G	1: 74,368,913		probably benign	Het
Ccdc138	T	C	10: 58,573,655	L602P	probably damaging	Het
Cilp	A	T	9: 65,279,880	T1086S	probably benign	Het
Comp	A	T	8: 70,374,382	I58F	possibly damaging	Het
Crygs	T	C	16: 22,805,518	E113G	possibly damaging	Het
Dnmt3b	C	T	2: 153,670,315	R319*	probably null	Het
Eif3a	A	G	19: 60,769,928	I804T	unknown	Het
Eif3a	A	T	19: 60,777,986	H301Q	probably benign	Het
Elf3	A	T	1: 135,256,740		probably benign	Het
Gm10384	A	G	15: 36,871,773		noncoding transcript	Het
Gm11627	T	A	11: 102,578,831		probably benign	Het
Gpr183	A	T	14: 121,954,849	Y87N	probably damaging	Het
Gpr183	G	C	14: 121,954,850	Y86*	probably null	Het
Gpr26	T	C	7: 131,966,980	V18A	probably damaging	Het
Herc1	T	A	9: 66,433,714		probably null	Het
Hint2	C	T	4: 43,656,396		probably benign	Het
Jag1	A	T	2: 137,085,979	D837E	probably damaging	Het
Jmjd1c	C	A	10: 67,157,974	S78*	probably null	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Krt1	C	T	15: 101,846,187	G543S	unknown	Het
Lalba	T	C	15: 98,482,668	M2V	probably benign	Het
Lama1	T	A	17: 67,794,300	D1929E	probably benign	Het
Macf1	T	C	4: 123,473,639	K878R	possibly damaging	Het
Mboat4	T	C	8: 34,123,954	S182P	probably damaging	Het
Muc5b	A	T	7: 141,857,984	T1556S	unknown	Het
Myo1g	T	C	11: 6,519,047	Y85C	probably damaging	Het
Ncapd2	C	A	6: 125,179,233		probably null	Het
Nox3	T	C	17: 3,693,982	D96G	possibly damaging	Het
Olfr23	T	C	11: 73,940,996	L250P	probably damaging	Het
Olfr514	T	C	7: 108,825,595	M135V	probably damaging	Het
Olfr805	A	G	10: 129,723,481	L21P	probably damaging	Het
Pacs1	C	T	19: 5,156,356		probably null	Het
Pgm5	C	A	19: 24,834,746	G141*	probably null	Het
Pld4	T	A	12: 112,765,064	V217D	probably damaging	Het
Ppp1r3c	T	C	19: 36,733,515	E285G	probably benign	Het
Pradc1	T	A	6: 85,447,293	M24L	possibly damaging	Het
Prepl	T	C	17: 85,083,231	T100A	probably benign	Het
Rmi2	C	T	16: 10,886,209	T138I	probably benign	Het
Rtkn	A	T	6: 83,152,182	K540*	probably null	Het
Sag	C	A	1: 87,834,618	T335K	probably damaging	Het
Setd4	A	G	16: 93,591,226	L124P	probably benign	Het
Sh3gl2	A	G	4: 85,379,409	D208G	probably damaging	Het
Sult4a1	T	C	15: 84,105,578	T8A	possibly damaging	Het
Tert	A	G	13: 73,648,991	D1116G	probably damaging	Het
Tlr4	A	G	4: 66,839,240	E90G	probably benign	Het
Tmem123	T	C	9: 7,791,392	L164P	probably damaging	Het
Tmem246	C	G	4: 49,586,254	V305L	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trak1	G	A	9: 121,454,425	R419Q	probably benign	Het
Trp53bp1	G	T	2: 121,207,887	A1490D	probably damaging	Het
Ttc16	T	C	2: 32,775,377		probably benign	Het
Tyw5	T	A	1: 57,388,527	Q306L	probably damaging	Het
Ube2j2	T	A	4: 155,955,258	I14N	probably damaging	Het
Vmn2r103	T	C	17: 19,793,696	I250T	probably benign	Het
Zar1	A	G	5: 72,580,906	V51A	probably benign	Het
Zbtb38	T	G	9: 96,688,851	N60T	probably damaging	Het
Zfp354a	T	C	11: 51,070,218	S417P	probably damaging	Het
Zfp410	A	T	12: 84,325,736	D112V	probably damaging	Het
Zfp518a	C	T	19: 40,912,979	Q451*	probably null	Het
Zfp64	T	C	2: 168,926,543	N383S	possibly damaging	Het
Zfp687	A	T	3: 95,012,488		probably null	Het

Other mutations in Pik3r4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Pik3r4	APN	9	105644604	missense	possibly damaging	0.75
IGL01617:Pik3r4	APN	9	105654965	missense	probably benign	0.33
IGL01764:Pik3r4	APN	9	105685122	splice site	probably benign
IGL01817:Pik3r4	APN	9	105650822	missense	probably damaging	1.00
IGL01830:Pik3r4	APN	9	105644955	missense	probably damaging	1.00
IGL01905:Pik3r4	APN	9	105644878	nonsense	probably null
IGL01947:Pik3r4	APN	9	105686150	missense	possibly damaging	0.91
IGL01985:Pik3r4	APN	9	105663045	missense	probably benign	0.03
IGL02321:Pik3r4	APN	9	105644478	missense	probably benign	0.04
IGL02389:Pik3r4	APN	9	105650331	missense	possibly damaging	0.88
IGL02898:Pik3r4	APN	9	105650406	missense	probably benign	0.21
IGL03037:Pik3r4	APN	9	105650813	missense	probably damaging	1.00
boteh	UTSW	9	105667938	splice site	probably null
IGL02835:Pik3r4	UTSW	9	105672706	missense	probably benign	0.07
R0011:Pik3r4	UTSW	9	105644637	missense	probably benign	0.01
R0312:Pik3r4	UTSW	9	105686210	missense	probably damaging	1.00
R0321:Pik3r4	UTSW	9	105648707	missense	probably damaging	1.00
R0482:Pik3r4	UTSW	9	105669045	missense	probably benign	0.04
R0645:Pik3r4	UTSW	9	105669187	splice site	probably benign
R0690:Pik3r4	UTSW	9	105653976	missense	possibly damaging	0.81
R0789:Pik3r4	UTSW	9	105685167	missense	probably benign	0.14
R0894:Pik3r4	UTSW	9	105667771	missense	possibly damaging	0.73
R0988:Pik3r4	UTSW	9	105687205	missense	probably damaging	0.97
R1123:Pik3r4	UTSW	9	105663129	missense	probably benign
R1172:Pik3r4	UTSW	9	105663174	missense	probably damaging	1.00
R1174:Pik3r4	UTSW	9	105663174	missense	probably damaging	1.00
R1342:Pik3r4	UTSW	9	105650901	critical splice donor site	probably null
R1387:Pik3r4	UTSW	9	105644291	missense	probably damaging	1.00
R1480:Pik3r4	UTSW	9	105687244	missense	probably benign	0.39
R1638:Pik3r4	UTSW	9	105687209	missense	probably damaging	1.00
R1643:Pik3r4	UTSW	9	105687152	missense	possibly damaging	0.83
R1995:Pik3r4	UTSW	9	105669165	missense	probably benign	0.12
R2037:Pik3r4	UTSW	9	105650335	missense	probably benign	0.00
R2165:Pik3r4	UTSW	9	105672785	missense	probably benign	0.05
R4210:Pik3r4	UTSW	9	105650758	missense	possibly damaging	0.57
R4515:Pik3r4	UTSW	9	105672725	missense	probably damaging	1.00
R4519:Pik3r4	UTSW	9	105672725	missense	probably damaging	1.00
R4632:Pik3r4	UTSW	9	105654899	missense	probably benign	0.06
R4732:Pik3r4	UTSW	9	105678176	missense	possibly damaging	0.56
R4733:Pik3r4	UTSW	9	105678176	missense	possibly damaging	0.56
R4940:Pik3r4	UTSW	9	105668994	missense	probably benign	0.20
R5120:Pik3r4	UTSW	9	105669009	missense	probably benign	0.30
R5169:Pik3r4	UTSW	9	105678161	missense	probably benign	0.14
R5183:Pik3r4	UTSW	9	105682308	missense	possibly damaging	0.87
R5353:Pik3r4	UTSW	9	105667938	splice site	probably null
R5463:Pik3r4	UTSW	9	105648731	missense	probably damaging	1.00
R5635:Pik3r4	UTSW	9	105667825	missense	probably benign	0.01
R5763:Pik3r4	UTSW	9	105669775	missense	probably benign	0.01
R5830:Pik3r4	UTSW	9	105644824	nonsense	probably null
R6251:Pik3r4	UTSW	9	105654048	missense	probably benign
R6468:Pik3r4	UTSW	9	105685190	missense	possibly damaging	0.86
R6611:Pik3r4	UTSW	9	105644277	missense	probably damaging	0.99
R6642:Pik3r4	UTSW	9	105644646	missense	probably benign	0.11
R6821:Pik3r4	UTSW	9	105650606	missense	probably damaging	0.98
R7039:Pik3r4	UTSW	9	105676890	missense	possibly damaging	0.76
R7144:Pik3r4	UTSW	9	105650584	missense	probably damaging	0.98
R7410:Pik3r4	UTSW	9	105650591	missense	probably damaging	0.99
R7559:Pik3r4	UTSW	9	105678153	missense	probably benign	0.17
R7561:Pik3r4	UTSW	9	105687247	missense	possibly damaging	0.94
R7658:Pik3r4	UTSW	9	105644511	missense	probably damaging	0.98
R7727:Pik3r4	UTSW	9	105669882	missense	probably damaging	0.99
R7871:Pik3r4	UTSW	9	105663117	missense	probably damaging	1.00
R7957:Pik3r4	UTSW	9	105687209	missense	probably damaging	1.00
R8138:Pik3r4	UTSW	9	105669035	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- GATTCCAAATGCCCCATCCG -3'
(R):5'- CAAACCAACGGAAGGCTTTG -3'

Sequencing Primer
(F):5'- GCGTGTGTGGATGAAATCTCCATC -3'
(R):5'- GGCTTTGAGAGGGCAATTTATAATC -3'

Posted On

2015-10-08