Incidental Mutation 'R4630:Vmn2r103'
ID 349151
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
MMRRC Submission 041895-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R4630 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 19993625-20032798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20013958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 250 (I250T)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect probably benign
Transcript: ENSMUST00000172203
AA Change: I250T

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: I250T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik A T 13: 119,624,622 (GRCm39) probably benign Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Aopep T C 13: 63,215,906 (GRCm39) S393P probably benign Het
BC024139 T G 15: 76,009,294 (GRCm39) Q240P probably benign Het
Bckdha A T 7: 25,330,884 (GRCm39) I44N probably damaging Het
Brpf1 T C 6: 113,286,867 (GRCm39) Y32H probably damaging Het
Catip A G 1: 74,408,072 (GRCm39) probably benign Het
Ccdc138 T C 10: 58,409,477 (GRCm39) L602P probably damaging Het
Cilp A T 9: 65,187,162 (GRCm39) T1086S probably benign Het
Comp A T 8: 70,827,032 (GRCm39) I58F possibly damaging Het
Crygs T C 16: 22,624,268 (GRCm39) E113G possibly damaging Het
Dnmt3b C T 2: 153,512,235 (GRCm39) R319* probably null Het
Eif3a A G 19: 60,758,366 (GRCm39) I804T unknown Het
Eif3a A T 19: 60,766,424 (GRCm39) H301Q probably benign Het
Elf3 A T 1: 135,184,478 (GRCm39) probably benign Het
Fads2b C A 2: 85,348,990 (GRCm39) G41* probably null Het
Gm10384 A G 15: 36,872,017 (GRCm39) noncoding transcript Het
Gm11627 T A 11: 102,469,657 (GRCm39) probably benign Het
Gpr183 A T 14: 122,192,261 (GRCm39) Y87N probably damaging Het
Gpr183 G C 14: 122,192,262 (GRCm39) Y86* probably null Het
Gpr26 T C 7: 131,568,709 (GRCm39) V18A probably damaging Het
Herc1 T A 9: 66,340,996 (GRCm39) probably null Het
Hint2 C T 4: 43,656,396 (GRCm39) probably benign Het
Jag1 A T 2: 136,927,899 (GRCm39) D837E probably damaging Het
Jmjd1c C A 10: 66,993,753 (GRCm39) S78* probably null Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Krt1 C T 15: 101,754,622 (GRCm39) G543S unknown Het
Lalba T C 15: 98,380,549 (GRCm39) M2V probably benign Het
Lama1 T A 17: 68,101,295 (GRCm39) D1929E probably benign Het
Macf1 T C 4: 123,367,432 (GRCm39) K878R possibly damaging Het
Mboat4 T C 8: 34,591,108 (GRCm39) S182P probably damaging Het
Muc5b A T 7: 141,411,721 (GRCm39) T1556S unknown Het
Myo1g T C 11: 6,469,047 (GRCm39) Y85C probably damaging Het
Ncapd2 C A 6: 125,156,196 (GRCm39) probably null Het
Nox3 T C 17: 3,744,257 (GRCm39) D96G possibly damaging Het
Or10a48 T C 7: 108,424,802 (GRCm39) M135V probably damaging Het
Or1e17 T C 11: 73,831,822 (GRCm39) L250P probably damaging Het
Or6c212 A G 10: 129,559,350 (GRCm39) L21P probably damaging Het
Pacs1 C T 19: 5,206,384 (GRCm39) probably null Het
Pgap4 C G 4: 49,586,254 (GRCm39) V305L probably benign Het
Pgm5 C A 19: 24,812,110 (GRCm39) G141* probably null Het
Pik3r4 A G 9: 105,532,098 (GRCm39) M557V probably benign Het
Pld4 T A 12: 112,731,498 (GRCm39) V217D probably damaging Het
Pphln1-ps1 T C 16: 13,495,278 (GRCm39) S126P probably damaging Het
Ppp1r3c T C 19: 36,710,915 (GRCm39) E285G probably benign Het
Pradc1 T A 6: 85,424,275 (GRCm39) M24L possibly damaging Het
Prepl T C 17: 85,390,659 (GRCm39) T100A probably benign Het
Rmi2 C T 16: 10,704,073 (GRCm39) T138I probably benign Het
Rtkn A T 6: 83,129,163 (GRCm39) K540* probably null Het
Sag C A 1: 87,762,340 (GRCm39) T335K probably damaging Het
Setd4 A G 16: 93,388,114 (GRCm39) L124P probably benign Het
Sh3gl2 A G 4: 85,297,646 (GRCm39) D208G probably damaging Het
Sult4a1 T C 15: 83,989,779 (GRCm39) T8A possibly damaging Het
Tert A G 13: 73,797,110 (GRCm39) D1116G probably damaging Het
Tlr4 A G 4: 66,757,477 (GRCm39) E90G probably benign Het
Tmem123 T C 9: 7,791,393 (GRCm39) L164P probably damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Trak1 G A 9: 121,283,491 (GRCm39) R419Q probably benign Het
Trp53bp1 G T 2: 121,038,368 (GRCm39) A1490D probably damaging Het
Ttc16 T C 2: 32,665,389 (GRCm39) probably benign Het
Tyw5 T A 1: 57,427,686 (GRCm39) Q306L probably damaging Het
Ube2j2 T A 4: 156,039,715 (GRCm39) I14N probably damaging Het
Zar1 A G 5: 72,738,249 (GRCm39) V51A probably benign Het
Zbtb38 T G 9: 96,570,904 (GRCm39) N60T probably damaging Het
Zfp354a T C 11: 50,961,045 (GRCm39) S417P probably damaging Het
Zfp410 A T 12: 84,372,510 (GRCm39) D112V probably damaging Het
Zfp518a C T 19: 40,901,423 (GRCm39) Q451* probably null Het
Zfp64 T C 2: 168,768,463 (GRCm39) N383S possibly damaging Het
Zfp687 A T 3: 94,919,799 (GRCm39) probably null Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 20,013,364 (GRCm39) missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 20,015,227 (GRCm39) missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 20,013,259 (GRCm39) missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 20,013,229 (GRCm39) missense probably benign
IGL01404:Vmn2r103 APN 17 20,032,696 (GRCm39) missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 20,014,330 (GRCm39) missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 20,019,470 (GRCm39) missense probably benign
IGL02251:Vmn2r103 APN 17 20,014,231 (GRCm39) missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19,993,631 (GRCm39) missense probably benign
IGL02555:Vmn2r103 APN 17 20,031,873 (GRCm39) missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 20,014,389 (GRCm39) missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 20,014,218 (GRCm39) missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 20,032,510 (GRCm39) missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19,993,782 (GRCm39) missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 20,032,241 (GRCm39) missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 20,031,903 (GRCm39) missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 20,013,726 (GRCm39) missense probably benign 0.12
R0375:Vmn2r103 UTSW 17 20,013,121 (GRCm39) missense probably benign 0.06
R0755:Vmn2r103 UTSW 17 19,993,830 (GRCm39) missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 20,014,189 (GRCm39) missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 20,014,509 (GRCm39) missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 20,013,230 (GRCm39) missense probably benign
R1488:Vmn2r103 UTSW 17 20,013,922 (GRCm39) missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19,993,662 (GRCm39) missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 20,014,496 (GRCm39) missense probably benign
R1928:Vmn2r103 UTSW 17 20,032,029 (GRCm39) missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 20,032,562 (GRCm39) missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 20,014,056 (GRCm39) missense probably benign
R2219:Vmn2r103 UTSW 17 20,013,909 (GRCm39) missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19,993,793 (GRCm39) missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 20,013,862 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 20,032,411 (GRCm39) missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 20,014,495 (GRCm39) missense probably benign 0.00
R4631:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 20,032,077 (GRCm39) missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 20,032,031 (GRCm39) missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 20,032,433 (GRCm39) missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 20,013,904 (GRCm39) missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 20,013,251 (GRCm39) missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 20,015,201 (GRCm39) missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 20,032,715 (GRCm39) missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 20,014,478 (GRCm39) nonsense probably null
R6114:Vmn2r103 UTSW 17 20,032,587 (GRCm39) missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 20,032,406 (GRCm39) missense probably benign
R6292:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 20,014,344 (GRCm39) missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 20,032,166 (GRCm39) missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 20,032,239 (GRCm39) missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 20,013,739 (GRCm39) missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 20,032,314 (GRCm39) missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 20,014,476 (GRCm39) missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 20,013,385 (GRCm39) missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 20,019,511 (GRCm39) missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 20,013,759 (GRCm39) missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 20,032,058 (GRCm39) missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 20,032,205 (GRCm39) missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 20,032,646 (GRCm39) missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 20,032,158 (GRCm39) missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 20,031,921 (GRCm39) missense possibly damaging 0.70
R9652:Vmn2r103 UTSW 17 20,014,027 (GRCm39) missense probably benign 0.01
R9680:Vmn2r103 UTSW 17 20,019,525 (GRCm39) nonsense probably null
R9743:Vmn2r103 UTSW 17 20,032,475 (GRCm39) missense probably damaging 1.00
Z1088:Vmn2r103 UTSW 17 20,015,309 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GACCATGGTCAGTATCCTTCTC -3'
(R):5'- GAGTCTAACATGAAATAGTCAGCTC -3'

Sequencing Primer
(F):5'- TCTCTACCAGATGGCCCCTAAGG -3'
(R):5'- GTCAGCTCTGTCAATAACATGATG -3'
Posted On 2015-10-08