Mutagenetix > Incidental Mutations

Incidental Mutation 'R4630:Lama1'

349152

Institutional Source

Beutler Lab

Gene Symbol

Lama1

Ensembl Gene

ENSMUSG00000032796

Gene Name

laminin, alpha 1

Synonyms

Lama

MMRRC Submission

041895-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4630 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67697265-67822645 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67794300 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1929 (D1929E)

Ref Sequence

ENSEMBL: ENSMUSP00000043957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035471]

Predicted Effect

probably benign
Transcript: ENSMUST00000035471
AA Change: D1929E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: D1929E

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
LamNT	23	275	1.2e-131	SMART
EGF_Lam	277	331	1e-5	SMART
EGF_Lam	334	401	6.6e-6	SMART
EGF_Lam	404	458	9.11e-9	SMART
EGF_Lam	461	507	8.12e-6	SMART
LamB	570	702	2.09e-57	SMART
EGF_like	715	746	3.36e0	SMART
EGF_Lam	749	795	7.01e-10	SMART
EGF_Lam	798	853	3.59e-7	SMART
EGF_Lam	856	906	1.53e-10	SMART
EGF_Lam	909	955	1.13e-13	SMART
EGF_Lam	958	1002	1.36e-7	SMART
EGF_Lam	1005	1048	7.29e-8	SMART
EGF_like	1034	1082	4.83e1	SMART
EGF_Lam	1051	1094	1.67e-7	SMART
EGF_Lam	1097	1154	1.32e-5	SMART
LamB	1220	1352	8.7e-46	SMART
Pfam:Laminin_EGF	1367	1397	1.7e-6	PFAM
EGF_Lam	1410	1456	7.12e-11	SMART
EGF_Lam	1459	1513	3.25e-5	SMART
EGF_like	1497	1547	6.41e1	SMART
EGF_Lam	1516	1560	1.71e-13	SMART
Pfam:Laminin_I	1574	1838	1.7e-91	PFAM
low complexity region	2012	2031	N/A	INTRINSIC
low complexity region	2087	2098	N/A	INTRINSIC
LamG	2145	2287	3.66e-30	SMART
LamG	2332	2473	5.98e-35	SMART
LamG	2513	2661	1.11e-29	SMART
low complexity region	2695	2708	N/A	INTRINSIC
LamG	2743	2877	9.72e-35	SMART
LamG	2920	3056	4.63e-41	SMART

Meta Mutation Damage Score

0.0608

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,068,092	S393P	probably benign	Het
3110001I22Rik	T	C	16: 13,677,414	S126P	probably damaging	Het
3110070M22Rik	A	T	13: 119,488,086		probably benign	Het
4833423E24Rik	C	A	2: 85,518,646	G41*	probably null	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
BC024139	T	G	15: 76,125,094	Q240P	probably benign	Het
Bckdha	A	T	7: 25,631,459	I44N	probably damaging	Het
Brpf1	T	C	6: 113,309,906	Y32H	probably damaging	Het
Catip	A	G	1: 74,368,913		probably benign	Het
Ccdc138	T	C	10: 58,573,655	L602P	probably damaging	Het
Cilp	A	T	9: 65,279,880	T1086S	probably benign	Het
Comp	A	T	8: 70,374,382	I58F	possibly damaging	Het
Crygs	T	C	16: 22,805,518	E113G	possibly damaging	Het
Dnmt3b	C	T	2: 153,670,315	R319*	probably null	Het
Eif3a	A	G	19: 60,769,928	I804T	unknown	Het
Eif3a	A	T	19: 60,777,986	H301Q	probably benign	Het
Elf3	A	T	1: 135,256,740		probably benign	Het
Gm10384	A	G	15: 36,871,773		noncoding transcript	Het
Gm11627	T	A	11: 102,578,831		probably benign	Het
Gpr183	A	T	14: 121,954,849	Y87N	probably damaging	Het
Gpr183	G	C	14: 121,954,850	Y86*	probably null	Het
Gpr26	T	C	7: 131,966,980	V18A	probably damaging	Het
Herc1	T	A	9: 66,433,714		probably null	Het
Hint2	C	T	4: 43,656,396		probably benign	Het
Jag1	A	T	2: 137,085,979	D837E	probably damaging	Het
Jmjd1c	C	A	10: 67,157,974	S78*	probably null	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Krt1	C	T	15: 101,846,187	G543S	unknown	Het
Lalba	T	C	15: 98,482,668	M2V	probably benign	Het
Macf1	T	C	4: 123,473,639	K878R	possibly damaging	Het
Mboat4	T	C	8: 34,123,954	S182P	probably damaging	Het
Muc5b	A	T	7: 141,857,984	T1556S	unknown	Het
Myo1g	T	C	11: 6,519,047	Y85C	probably damaging	Het
Ncapd2	C	A	6: 125,179,233		probably null	Het
Nox3	T	C	17: 3,693,982	D96G	possibly damaging	Het
Olfr23	T	C	11: 73,940,996	L250P	probably damaging	Het
Olfr514	T	C	7: 108,825,595	M135V	probably damaging	Het
Olfr805	A	G	10: 129,723,481	L21P	probably damaging	Het
Pacs1	C	T	19: 5,156,356		probably null	Het
Pgm5	C	A	19: 24,834,746	G141*	probably null	Het
Pik3r4	A	G	9: 105,654,899	M557V	probably benign	Het
Pld4	T	A	12: 112,765,064	V217D	probably damaging	Het
Ppp1r3c	T	C	19: 36,733,515	E285G	probably benign	Het
Pradc1	T	A	6: 85,447,293	M24L	possibly damaging	Het
Prepl	T	C	17: 85,083,231	T100A	probably benign	Het
Rmi2	C	T	16: 10,886,209	T138I	probably benign	Het
Rtkn	A	T	6: 83,152,182	K540*	probably null	Het
Sag	C	A	1: 87,834,618	T335K	probably damaging	Het
Setd4	A	G	16: 93,591,226	L124P	probably benign	Het
Sh3gl2	A	G	4: 85,379,409	D208G	probably damaging	Het
Sult4a1	T	C	15: 84,105,578	T8A	possibly damaging	Het
Tert	A	G	13: 73,648,991	D1116G	probably damaging	Het
Tlr4	A	G	4: 66,839,240	E90G	probably benign	Het
Tmem123	T	C	9: 7,791,392	L164P	probably damaging	Het
Tmem246	C	G	4: 49,586,254	V305L	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trak1	G	A	9: 121,454,425	R419Q	probably benign	Het
Trp53bp1	G	T	2: 121,207,887	A1490D	probably damaging	Het
Ttc16	T	C	2: 32,775,377		probably benign	Het
Tyw5	T	A	1: 57,388,527	Q306L	probably damaging	Het
Ube2j2	T	A	4: 155,955,258	I14N	probably damaging	Het
Vmn2r103	T	C	17: 19,793,696	I250T	probably benign	Het
Zar1	A	G	5: 72,580,906	V51A	probably benign	Het
Zbtb38	T	G	9: 96,688,851	N60T	probably damaging	Het
Zfp354a	T	C	11: 51,070,218	S417P	probably damaging	Het
Zfp410	A	T	12: 84,325,736	D112V	probably damaging	Het
Zfp518a	C	T	19: 40,912,979	Q451*	probably null	Het
Zfp64	T	C	2: 168,926,543	N383S	possibly damaging	Het
Zfp687	A	T	3: 95,012,488		probably null	Het

Other mutations in Lama1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Lama1	APN	17	67815928	missense	probably benign
IGL00336:Lama1	APN	17	67813948	missense	probably benign	0.07
IGL01066:Lama1	APN	17	67743326	missense	probably damaging	1.00
IGL01140:Lama1	APN	17	67802933	missense	probably benign	0.14
IGL01291:Lama1	APN	17	67738870	missense	probably damaging	1.00
IGL01296:Lama1	APN	17	67745051	missense	probably benign	0.27
IGL01317:Lama1	APN	17	67818701	missense	probably damaging	1.00
IGL01490:Lama1	APN	17	67750584	missense	possibly damaging	0.54
IGL01506:Lama1	APN	17	67785070	missense	probably benign	0.01
IGL01508:Lama1	APN	17	67809361	splice site	probably benign
IGL01522:Lama1	APN	17	67752774	splice site	probably benign
IGL01530:Lama1	APN	17	67796790	missense	probably benign	0.02
IGL01541:Lama1	APN	17	67785070	missense	probably benign	0.01
IGL01677:Lama1	APN	17	67779148	missense	probably benign	0.15
IGL01886:Lama1	APN	17	67807797	missense	probably benign	0.36
IGL01994:Lama1	APN	17	67752439	missense	probably benign	0.05
IGL02017:Lama1	APN	17	67764725	missense	probably benign	0.00
IGL02021:Lama1	APN	17	67821626	missense	probably damaging	1.00
IGL02026:Lama1	APN	17	67809292	missense	possibly damaging	0.82
IGL02044:Lama1	APN	17	67811490	missense	probably benign	0.01
IGL02120:Lama1	APN	17	67716789	missense	probably damaging	1.00
IGL02425:Lama1	APN	17	67811485	missense	probably benign	0.45
IGL02549:Lama1	APN	17	67790835	missense	possibly damaging	0.93
IGL02642:Lama1	APN	17	67812366	missense	probably benign	0.00
IGL02795:Lama1	APN	17	67738894	splice site	probably null
IGL02798:Lama1	APN	17	67795191	splice site	probably benign
IGL02863:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02870:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02876:Lama1	APN	17	67750692	critical splice donor site	probably null
IGL02885:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02891:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02978:Lama1	APN	17	67786081	nonsense	probably null
IGL03064:Lama1	APN	17	67779104	missense	probably benign	0.01
IGL03076:Lama1	APN	17	67716799	missense	possibly damaging	0.95
IGL03110:Lama1	APN	17	67798986	missense	probably benign	0.04
IGL03143:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL03159:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL03268:Lama1	APN	17	67804536	missense	probably damaging	0.99
ANU05:Lama1	UTSW	17	67738870	missense	probably damaging	1.00
PIT4472001:Lama1	UTSW	17	67764704	missense
R0047:Lama1	UTSW	17	67795186	splice site	probably benign
R0047:Lama1	UTSW	17	67795186	splice site	probably benign
R0050:Lama1	UTSW	17	67782056	missense	possibly damaging	0.66
R0096:Lama1	UTSW	17	67805413	missense	probably benign	0.12
R0096:Lama1	UTSW	17	67805413	missense	probably benign	0.12
R0111:Lama1	UTSW	17	67737498	missense	probably damaging	0.98
R0116:Lama1	UTSW	17	67776923	missense	probably benign	0.10
R0121:Lama1	UTSW	17	67798513	splice site	probably benign
R0278:Lama1	UTSW	17	67810183	missense	probably null	0.98
R0281:Lama1	UTSW	17	67817569	missense	probably damaging	1.00
R0312:Lama1	UTSW	17	67775851	missense	possibly damaging	0.45
R0419:Lama1	UTSW	17	67791610	critical splice donor site	probably null
R0512:Lama1	UTSW	17	67779134	missense	possibly damaging	0.67
R0514:Lama1	UTSW	17	67764698	missense	probably benign	0.40
R0562:Lama1	UTSW	17	67815959	missense	probably damaging	1.00
R0632:Lama1	UTSW	17	67752368	splice site	probably benign
R0645:Lama1	UTSW	17	67773712	missense	probably benign	0.01
R0712:Lama1	UTSW	17	67779042	splice site	probably null
R0763:Lama1	UTSW	17	67772818	missense	probably damaging	0.97
R0941:Lama1	UTSW	17	67775865	missense	probably benign	0.10
R1025:Lama1	UTSW	17	67752898	missense	probably benign	0.00
R1084:Lama1	UTSW	17	67804469	missense	probably benign	0.12
R1103:Lama1	UTSW	17	67790947	missense	probably damaging	0.98
R1420:Lama1	UTSW	17	67790947	missense	probably damaging	0.98
R1430:Lama1	UTSW	17	67782155	missense	possibly damaging	0.95
R1569:Lama1	UTSW	17	67780618	splice site	probably null
R1575:Lama1	UTSW	17	67810409	missense	possibly damaging	0.96
R1613:Lama1	UTSW	17	67807923	missense	probably benign	0.42
R1620:Lama1	UTSW	17	67767033	missense	probably benign	0.01
R1629:Lama1	UTSW	17	67805428	missense	probably benign	0.00
R1645:Lama1	UTSW	17	67737682	missense	probably benign	0.14
R1652:Lama1	UTSW	17	67807846	missense	probably damaging	0.97
R1674:Lama1	UTSW	17	67791244	missense	probably benign
R1678:Lama1	UTSW	17	67810155	missense	possibly damaging	0.56
R1710:Lama1	UTSW	17	67753791	missense	probably benign	0.00
R1712:Lama1	UTSW	17	67717186	missense	possibly damaging	0.95
R1737:Lama1	UTSW	17	67802921	missense	probably benign	0.36
R1757:Lama1	UTSW	17	67763836	missense	probably benign	0.40
R1757:Lama1	UTSW	17	67697383	missense	unknown
R1813:Lama1	UTSW	17	67791223	missense	probably benign
R1896:Lama1	UTSW	17	67791223	missense	probably benign
R1945:Lama1	UTSW	17	67745853	missense	probably benign	0.14
R2086:Lama1	UTSW	17	67817623	missense	probably damaging	1.00
R2149:Lama1	UTSW	17	67773865	missense	possibly damaging	0.95
R2178:Lama1	UTSW	17	67769515	missense	probably benign	0.07
R2183:Lama1	UTSW	17	67791009	missense	probably damaging	0.98
R2197:Lama1	UTSW	17	67752941	missense	probably benign	0.02
R2213:Lama1	UTSW	17	67777034	nonsense	probably null
R2260:Lama1	UTSW	17	67737507	missense	probably damaging	0.96
R2356:Lama1	UTSW	17	67810114	missense	probably damaging	1.00
R2420:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2421:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2422:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2424:Lama1	UTSW	17	67798665	missense	probably benign	0.09
R2442:Lama1	UTSW	17	67768317	missense	probably benign	0.04
R3147:Lama1	UTSW	17	67737658	missense	probably damaging	0.98
R3414:Lama1	UTSW	17	67737603	missense	probably damaging	1.00
R3683:Lama1	UTSW	17	67768333	missense	probably benign	0.40
R3820:Lama1	UTSW	17	67779046	splice site	probably null
R3821:Lama1	UTSW	17	67779046	splice site	probably null
R3822:Lama1	UTSW	17	67779046	splice site	probably null
R4012:Lama1	UTSW	17	67812373	nonsense	probably null
R4113:Lama1	UTSW	17	67764703	missense	probably benign	0.01
R4133:Lama1	UTSW	17	67750655	missense	probably damaging	0.98
R4133:Lama1	UTSW	17	67812486	missense	probably damaging	1.00
R4259:Lama1	UTSW	17	67752418	missense	possibly damaging	0.95
R4278:Lama1	UTSW	17	67791517	missense	probably null	0.00
R4321:Lama1	UTSW	17	67771083	missense	probably benign	0.03
R4374:Lama1	UTSW	17	67804518	missense	probably benign	0.00
R4386:Lama1	UTSW	17	67773712	missense	probably benign	0.01
R4463:Lama1	UTSW	17	67761700	missense	probably damaging	1.00
R4629:Lama1	UTSW	17	67805360	critical splice acceptor site	probably null
R4633:Lama1	UTSW	17	67798584	missense	probably damaging	0.96
R4668:Lama1	UTSW	17	67752434	missense	probably benign	0.27
R4684:Lama1	UTSW	17	67773778	missense	possibly damaging	0.88
R4745:Lama1	UTSW	17	67738780	missense	probably damaging	1.00
R4786:Lama1	UTSW	17	67773859	missense	possibly damaging	0.77
R4797:Lama1	UTSW	17	67716775	missense	probably benign	0.04
R4803:Lama1	UTSW	17	67809271	missense	probably damaging	1.00
R4925:Lama1	UTSW	17	67794314	missense	probably benign	0.02
R4939:Lama1	UTSW	17	67737475	missense	possibly damaging	0.91
R4952:Lama1	UTSW	17	67767566	critical splice donor site	probably null
R4975:Lama1	UTSW	17	67738834	missense	possibly damaging	0.95
R4977:Lama1	UTSW	17	67737682	missense	probably damaging	1.00
R5039:Lama1	UTSW	17	67745893	missense	possibly damaging	0.66
R5047:Lama1	UTSW	17	67743281	nonsense	probably null
R5195:Lama1	UTSW	17	67764800	missense	probably benign	0.13
R5230:Lama1	UTSW	17	67745083	nonsense	probably null
R5236:Lama1	UTSW	17	67804492	missense	probably benign	0.24
R5254:Lama1	UTSW	17	67756716	missense	probably benign	0.01
R5345:Lama1	UTSW	17	67817563	missense	probably benign
R5438:Lama1	UTSW	17	67800774	missense	possibly damaging	0.92
R5521:Lama1	UTSW	17	67780894	nonsense	probably null
R5568:Lama1	UTSW	17	67768298	critical splice acceptor site	probably null
R5645:Lama1	UTSW	17	67802948	missense	probably damaging	1.00
R5665:Lama1	UTSW	17	67770987	missense	probably damaging	1.00
R5727:Lama1	UTSW	17	67815224	missense	possibly damaging	0.81
R5757:Lama1	UTSW	17	67738787	missense	possibly damaging	0.59
R5795:Lama1	UTSW	17	67796727	missense	probably benign	0.02
R5857:Lama1	UTSW	17	67807843	missense	probably damaging	0.99
R5894:Lama1	UTSW	17	67779047	critical splice acceptor site	probably null
R5974:Lama1	UTSW	17	67773727	missense	probably benign	0.31
R6032:Lama1	UTSW	17	67750643	missense	probably benign	0.01
R6032:Lama1	UTSW	17	67750643	missense	probably benign	0.01
R6120:Lama1	UTSW	17	67780617	critical splice donor site	probably null
R6219:Lama1	UTSW	17	67790856	missense	probably benign	0.08
R6224:Lama1	UTSW	17	67802987	missense	possibly damaging	0.56
R6249:Lama1	UTSW	17	67798604	missense	probably benign
R6265:Lama1	UTSW	17	67750655	missense	probably damaging	0.98
R6276:Lama1	UTSW	17	67784088	splice site	probably null
R6284:Lama1	UTSW	17	67810096	missense	probably damaging	0.99
R6337:Lama1	UTSW	17	67786019	missense	probably benign	0.27
R6414:Lama1	UTSW	17	67746910	critical splice donor site	probably null
R6631:Lama1	UTSW	17	67774482	missense	probably benign	0.21
R6659:Lama1	UTSW	17	67818635	missense	probably damaging	1.00
R6660:Lama1	UTSW	17	67804500	missense	probably benign	0.05
R6677:Lama1	UTSW	17	67795233	missense	probably benign	0.14
R6763:Lama1	UTSW	17	67746873	missense	unknown
R6787:Lama1	UTSW	17	67784025	missense	unknown
R6831:Lama1	UTSW	17	67756754	missense	possibly damaging	0.89
R6855:Lama1	UTSW	17	67782155	missense	possibly damaging	0.95
R6910:Lama1	UTSW	17	67791464	missense	possibly damaging	0.60
R6934:Lama1	UTSW	17	67774543	missense	probably benign	0.04
R6945:Lama1	UTSW	17	67813866	missense
R6984:Lama1	UTSW	17	67779112	missense
R6989:Lama1	UTSW	17	67753758	missense
R6994:Lama1	UTSW	17	67753825	missense
R6995:Lama1	UTSW	17	67753825	missense
R7035:Lama1	UTSW	17	67781049	missense
R7133:Lama1	UTSW	17	67782146	missense
R7172:Lama1	UTSW	17	67804545	missense
R7197:Lama1	UTSW	17	67737705	nonsense	probably null
R7217:Lama1	UTSW	17	67764673	missense
R7229:Lama1	UTSW	17	67752446	missense
R7264:Lama1	UTSW	17	67743297	missense
R7311:Lama1	UTSW	17	67767385	missense
R7394:Lama1	UTSW	17	67717261	missense
R7419:Lama1	UTSW	17	67717174	missense
R7460:Lama1	UTSW	17	67767018	missense
R7492:Lama1	UTSW	17	67817651	missense
R7494:Lama1	UTSW	17	67811446	missense
R7552:Lama1	UTSW	17	67737667	missense
R7576:Lama1	UTSW	17	67782041	missense
R7583:Lama1	UTSW	17	67761621	missense
R7649:Lama1	UTSW	17	67737554	missense
R7663:Lama1	UTSW	17	67780880	missense
R7667:Lama1	UTSW	17	67780597	missense
R7688:Lama1	UTSW	17	67761628	missense
R7693:Lama1	UTSW	17	67817031	missense
R7748:Lama1	UTSW	17	67750590	missense
R7778:Lama1	UTSW	17	67804473	missense
R7824:Lama1	UTSW	17	67804473	missense
R7861:Lama1	UTSW	17	67809221	missense
R7884:Lama1	UTSW	17	67769435	missense
R8029:Lama1	UTSW	17	67817594	missense
R8078:Lama1	UTSW	17	67791294	missense
R8101:Lama1	UTSW	17	67745922	missense
R8313:Lama1	UTSW	17	67750520	missense
R8356:Lama1	UTSW	17	67737496	missense
R8366:Lama1	UTSW	17	67818704	missense
R8403:Lama1	UTSW	17	67745923	missense
R8456:Lama1	UTSW	17	67737496	missense
R8466:Lama1	UTSW	17	67813953	missense
RF001:Lama1	UTSW	17	67752902	missense
RF013:Lama1	UTSW	17	67781062	missense
V8831:Lama1	UTSW	17	67752883	missense	probably benign	0.00
X0024:Lama1	UTSW	17	67738888	missense	probably damaging	1.00
X0028:Lama1	UTSW	17	67767422	missense	probably benign	0.00
X0028:Lama1	UTSW	17	67794310	missense	probably benign	0.06
X0066:Lama1	UTSW	17	67811566	missense	probably damaging	1.00
Z1088:Lama1	UTSW	17	67752883	missense	probably benign	0.00
Z1088:Lama1	UTSW	17	67771082	missense	probably benign	0.25
Z1088:Lama1	UTSW	17	67810171	missense	probably damaging	1.00
Z1176:Lama1	UTSW	17	67752883	missense	probably benign	0.00
Z1177:Lama1	UTSW	17	67752883	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCCATGAATGTGTCCACTAATC -3'
(R):5'- TAGAGCCACCGAGTGTATGCTC -3'

Sequencing Primer
(F):5'- CATGAATGTGTCCACTAATCGTTTC -3'
(R):5'- TTCTAGAGCAGAGCTTCTCAAC -3'

Posted On

2015-10-08