Incidental Mutation 'R4631:Sh3bp4'
ID 349163
Institutional Source Beutler Lab
Gene Symbol Sh3bp4
Ensembl Gene ENSMUSG00000036206
Gene Name SH3-domain binding protein 4
Synonyms BOG25
MMRRC Submission 041896-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4631 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 88998137-89082790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 89071995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 281 (D281A)
Ref Sequence ENSEMBL: ENSMUSP00000067581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066279]
AlphaFold Q921I6
Predicted Effect probably damaging
Transcript: ENSMUST00000066279
AA Change: D281A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206
AA Change: D281A

DomainStartEndE-ValueType
SH3 58 113 5.04e-13 SMART
low complexity region 196 212 N/A INTRINSIC
Pfam:ZU5 318 411 1.8e-12 PFAM
Pfam:SH3_2 657 721 3.5e-13 PFAM
Meta Mutation Damage Score 0.0941 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,165,270 (GRCm39) L368Q probably damaging Het
Abcc2 C T 19: 43,803,146 (GRCm39) P661S possibly damaging Het
Adgre4 T G 17: 56,121,305 (GRCm39) M457R probably null Het
Ank C A 15: 27,467,176 (GRCm39) F29L probably benign Het
Arhgap20 T C 9: 51,751,653 (GRCm39) probably benign Het
Atf6 T C 1: 170,574,766 (GRCm39) probably null Het
Bhmt1b G A 18: 87,774,525 (GRCm39) R16H probably damaging Het
Bod1l A G 5: 41,975,078 (GRCm39) F2079L probably damaging Het
Cd163 T C 6: 124,306,045 (GRCm39) *1122Q probably null Het
Ces2g T C 8: 105,694,094 (GRCm39) probably null Het
Cntnap3 A G 13: 64,926,697 (GRCm39) Y558H probably benign Het
Ctsm T A 13: 61,685,510 (GRCm39) S301C probably null Het
Dlc1 A C 8: 37,404,712 (GRCm39) probably null Het
Dlg2 A T 7: 91,737,822 (GRCm39) I435F probably damaging Het
Dnah5 T C 15: 28,402,099 (GRCm39) V3420A probably damaging Het
Dnah5 T A 15: 28,420,140 (GRCm39) Y3813N probably damaging Het
Dnajc13 A G 9: 104,067,616 (GRCm39) M1181T probably damaging Het
Drc3 C A 11: 60,255,734 (GRCm39) T107N probably benign Het
Dydc2 T C 14: 40,771,286 (GRCm39) E131G probably benign Het
Eif5b T C 1: 38,080,828 (GRCm39) V723A probably damaging Het
Fndc9 C A 11: 46,128,675 (GRCm39) H65N possibly damaging Het
Fzd1 A T 5: 4,805,865 (GRCm39) Y572* probably null Het
Gps1 T A 11: 120,679,065 (GRCm39) probably null Het
Gvin3 A G 7: 106,198,730 (GRCm39) noncoding transcript Het
Kazn G A 4: 141,845,471 (GRCm39) probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kcnip1 T A 11: 33,942,821 (GRCm39) noncoding transcript Het
Kif19a A G 11: 114,675,673 (GRCm39) I382V possibly damaging Het
Krt1 C T 15: 101,754,622 (GRCm39) G543S unknown Het
Malsu1 A T 6: 49,061,467 (GRCm39) E177V probably damaging Het
Man2a2 A G 7: 80,012,211 (GRCm39) F649L probably benign Het
Map3k11 A G 19: 5,740,941 (GRCm39) I223V probably benign Het
Mroh2a A G 1: 88,186,386 (GRCm39) S64G probably benign Het
Myh9 T G 15: 77,681,228 (GRCm39) D164A probably damaging Het
Myo16 T C 8: 10,556,984 (GRCm39) I1040T probably damaging Het
Myo18b C T 5: 112,994,266 (GRCm39) A896T probably damaging Het
Myocd G T 11: 65,069,685 (GRCm39) N798K probably benign Het
Or13c7b T C 4: 43,820,563 (GRCm39) D266G probably benign Het
Or1n1b T G 2: 36,780,630 (GRCm39) T77P probably benign Het
Or2l13b G A 16: 19,348,891 (GRCm39) R260* probably null Het
Or4c11 C T 2: 88,695,174 (GRCm39) T75I probably benign Het
Or4g7 T A 2: 111,309,908 (GRCm39) W260R probably damaging Het
Or52a5 A T 7: 103,426,682 (GRCm39) L290Q probably damaging Het
Or5b105 T A 19: 13,080,636 (GRCm39) I11F probably benign Het
Pcdh18 T A 3: 49,710,890 (GRCm39) I142F probably damaging Het
Pcyox1 T C 6: 86,366,212 (GRCm39) E334G possibly damaging Het
Pcyox1 T C 6: 86,366,125 (GRCm39) D363G probably benign Het
Pgm2 A G 5: 64,263,290 (GRCm39) probably null Het
Plagl1 T G 10: 13,003,743 (GRCm39) probably benign Het
Ppp1r9a A G 6: 4,906,537 (GRCm39) D364G possibly damaging Het
Rab2b T A 14: 52,503,699 (GRCm39) H141L possibly damaging Het
Rev3l A G 10: 39,704,412 (GRCm39) K279E probably benign Het
Rnf111 G T 9: 70,357,678 (GRCm39) T607N probably benign Het
Scn8a C A 15: 100,914,384 (GRCm39) S1130* probably null Het
Selenbp1 A G 3: 94,851,879 (GRCm39) *473W probably null Het
Skint5 T A 4: 113,486,314 (GRCm39) probably null Het
Slc1a4 A G 11: 20,258,452 (GRCm39) L249P probably damaging Het
Slc45a2 T A 15: 11,012,662 (GRCm39) S222T probably benign Het
Slc7a4 A G 16: 17,392,255 (GRCm39) F393S probably damaging Het
Slc9a2 A T 1: 40,801,078 (GRCm39) D536V possibly damaging Het
Stra6 T A 9: 58,048,115 (GRCm39) probably benign Het
Tmem145 A G 7: 25,007,250 (GRCm39) D156G probably benign Het
Tns3 A C 11: 8,401,119 (GRCm39) F1060V probably benign Het
Trak1 G A 9: 121,283,491 (GRCm39) R419Q probably benign Het
Trappc8 A G 18: 21,000,865 (GRCm39) S273P probably benign Het
Trmt11 A G 10: 30,435,200 (GRCm39) S320P probably benign Het
Ugt1a6a A T 1: 88,066,980 (GRCm39) Y262F probably benign Het
Vmn1r73 G A 7: 11,490,758 (GRCm39) C192Y probably benign Het
Vmn2r103 T C 17: 20,013,958 (GRCm39) I250T probably benign Het
Vmn2r25 T A 6: 123,829,962 (GRCm39) D63V possibly damaging Het
Vps13b C T 15: 35,646,278 (GRCm39) H1461Y possibly damaging Het
Ythdc2 A T 18: 45,020,698 (GRCm39) E1427D probably benign Het
Zbed6 A T 1: 133,586,482 (GRCm39) V285E probably damaging Het
Zbtb26 A G 2: 37,326,968 (GRCm39) F23L probably benign Het
Zfp62 T A 11: 49,108,632 (GRCm39) *908R probably null Het
Zfp975 A T 7: 42,312,369 (GRCm39) N81K probably benign Het
Zkscan16 G A 4: 58,951,918 (GRCm39) V198M probably damaging Het
Other mutations in Sh3bp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sh3bp4 APN 1 89,071,682 (GRCm39) missense probably benign
IGL01344:Sh3bp4 APN 1 89,080,958 (GRCm39) missense probably benign
IGL02025:Sh3bp4 APN 1 89,073,008 (GRCm39) missense probably benign 0.40
IGL02035:Sh3bp4 APN 1 89,071,412 (GRCm39) missense probably benign 0.00
IGL02389:Sh3bp4 APN 1 89,072,870 (GRCm39) missense probably damaging 0.99
IGL02430:Sh3bp4 APN 1 89,080,885 (GRCm39) missense probably null 0.00
IGL02546:Sh3bp4 APN 1 89,071,266 (GRCm39) splice site probably benign
IGL03327:Sh3bp4 APN 1 89,071,885 (GRCm39) nonsense probably null
I0000:Sh3bp4 UTSW 1 89,065,518 (GRCm39) missense probably benign 0.01
PIT4366001:Sh3bp4 UTSW 1 89,073,156 (GRCm39) missense probably benign
R0128:Sh3bp4 UTSW 1 89,073,036 (GRCm39) missense possibly damaging 0.54
R0130:Sh3bp4 UTSW 1 89,073,036 (GRCm39) missense possibly damaging 0.54
R1370:Sh3bp4 UTSW 1 89,071,494 (GRCm39) missense probably benign 0.43
R1500:Sh3bp4 UTSW 1 89,073,210 (GRCm39) missense probably damaging 1.00
R2269:Sh3bp4 UTSW 1 89,073,314 (GRCm39) missense possibly damaging 0.62
R3407:Sh3bp4 UTSW 1 89,072,769 (GRCm39) missense possibly damaging 0.86
R3408:Sh3bp4 UTSW 1 89,072,769 (GRCm39) missense possibly damaging 0.86
R3615:Sh3bp4 UTSW 1 89,065,427 (GRCm39) missense probably damaging 0.99
R3616:Sh3bp4 UTSW 1 89,065,427 (GRCm39) missense probably damaging 0.99
R3721:Sh3bp4 UTSW 1 89,073,050 (GRCm39) missense possibly damaging 0.93
R3983:Sh3bp4 UTSW 1 89,073,591 (GRCm39) missense probably benign 0.00
R5024:Sh3bp4 UTSW 1 89,073,317 (GRCm39) missense probably damaging 1.00
R5040:Sh3bp4 UTSW 1 89,071,962 (GRCm39) missense probably damaging 1.00
R5249:Sh3bp4 UTSW 1 89,065,456 (GRCm39) missense probably damaging 1.00
R5306:Sh3bp4 UTSW 1 89,071,997 (GRCm39) missense probably damaging 0.99
R5319:Sh3bp4 UTSW 1 89,073,072 (GRCm39) missense probably benign
R5908:Sh3bp4 UTSW 1 89,073,605 (GRCm39) missense probably damaging 0.99
R6296:Sh3bp4 UTSW 1 89,073,211 (GRCm39) missense probably damaging 1.00
R6572:Sh3bp4 UTSW 1 89,072,643 (GRCm39) missense possibly damaging 0.78
R6660:Sh3bp4 UTSW 1 89,080,888 (GRCm39) missense possibly damaging 0.62
R6900:Sh3bp4 UTSW 1 89,073,489 (GRCm39) missense probably benign 0.00
R7319:Sh3bp4 UTSW 1 89,080,824 (GRCm39) splice site probably null
R7320:Sh3bp4 UTSW 1 89,073,216 (GRCm39) missense probably damaging 1.00
R7393:Sh3bp4 UTSW 1 89,072,170 (GRCm39) missense possibly damaging 0.79
R7516:Sh3bp4 UTSW 1 89,073,368 (GRCm39) missense probably damaging 1.00
R8402:Sh3bp4 UTSW 1 89,073,037 (GRCm39) missense probably benign 0.00
R8899:Sh3bp4 UTSW 1 89,073,297 (GRCm39) missense probably benign 0.45
R8915:Sh3bp4 UTSW 1 89,080,064 (GRCm39) missense probably damaging 0.99
R8953:Sh3bp4 UTSW 1 89,072,159 (GRCm39) missense probably damaging 0.97
R9137:Sh3bp4 UTSW 1 89,072,647 (GRCm39) nonsense probably null
R9718:Sh3bp4 UTSW 1 89,073,472 (GRCm39) missense probably damaging 0.99
RF016:Sh3bp4 UTSW 1 89,072,744 (GRCm39) missense probably benign
Z1176:Sh3bp4 UTSW 1 89,073,450 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ATCTTTGATGAGCTCCCAGC -3'
(R):5'- AATCTGCTGTGTCTCCCCAG -3'

Sequencing Primer
(F):5'- TGAGCTCCCAGCCACCAATG -3'
(R):5'- CCTCTGGCACATGGATACTGATG -3'
Posted On 2015-10-08