Mutagenetix > Incidental Mutation

Incidental Mutation 'R4631:Sh3bp4'

349163

Institutional Source

Beutler Lab

Gene Symbol

Sh3bp4

Ensembl Gene

ENSMUSG00000036206

Gene Name

SH3-domain binding protein 4

Synonyms

BOG25

MMRRC Submission

041896-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4631 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89070415-89155068 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 89144273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 281 (D281A)

Ref Sequence

ENSEMBL: ENSMUSP00000067581 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066279]

AlphaFold

Q921I6

Predicted Effect

probably damaging
Transcript: ENSMUST00000066279
AA Change: D281A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206
AA Change: D281A

Domain	Start	End	E-Value	Type
SH3	58	113	5.04e-13	SMART
low complexity region	196	212	N/A	INTRINSIC
Pfam:ZU5	318	411	1.8e-12	PFAM
Pfam:SH3_2	657	721	3.5e-13	PFAM

Meta Mutation Damage Score

0.0941

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (84/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	T	9: 57,257,987	L368Q	probably damaging	Het
Abcc2	C	T	19: 43,814,707	P661S	possibly damaging	Het
Adgre4	T	G	17: 55,814,305	M457R	probably null	Het
Ank	C	A	15: 27,467,090	F29L	probably benign	Het
Arhgap20	T	C	9: 51,840,353		probably benign	Het
Atf6	T	C	1: 170,747,197		probably null	Het
Bod1l	A	G	5: 41,817,735	F2079L	probably damaging	Het
Cd163	T	C	6: 124,329,086	*1122Q	probably null	Het
Ces2g	T	C	8: 104,967,462		probably null	Het
Cntnap3	A	G	13: 64,778,883	Y558H	probably benign	Het
Ctsm	T	A	13: 61,537,696	S301C	probably null	Het
Dlc1	A	C	8: 36,937,558		probably null	Het
Dlg2	A	T	7: 92,088,614	I435F	probably damaging	Het
Dnah5	T	C	15: 28,401,953	V3420A	probably damaging	Het
Dnah5	T	A	15: 28,419,994	Y3813N	probably damaging	Het
Dnajc13	A	G	9: 104,190,417	M1181T	probably damaging	Het
Drc3	C	A	11: 60,364,908	T107N	probably benign	Het
Dydc2	T	C	14: 41,049,329	E131G	probably benign	Het
Eif5b	T	C	1: 38,041,747	V723A	probably damaging	Het
Fndc9	C	A	11: 46,237,848	H65N	possibly damaging	Het
Fzd1	A	T	5: 4,755,865	Y572*	probably null	Het
Gm1966	A	G	7: 106,599,523		noncoding transcript	Het
Gm38394	A	T	1: 133,658,744	V285E	probably damaging	Het
Gm5096	G	A	18: 87,756,401	R16H	probably damaging	Het
Gps1	T	A	11: 120,788,239		probably null	Het
Kazn	G	A	4: 142,118,160		probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kcnip1	T	A	11: 33,992,821		noncoding transcript	Het
Kif19a	A	G	11: 114,784,847	I382V	possibly damaging	Het
Krt1	C	T	15: 101,846,187	G543S	unknown	Het
Malsu1	A	T	6: 49,084,533	E177V	probably damaging	Het
Man2a2	A	G	7: 80,362,463	F649L	probably benign	Het
Map3k11	A	G	19: 5,690,913	I223V	probably benign	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Myh9	T	G	15: 77,797,028	D164A	probably damaging	Het
Myo16	T	C	8: 10,506,984	I1040T	probably damaging	Het
Myo18b	C	T	5: 112,846,400	A896T	probably damaging	Het
Myocd	G	T	11: 65,178,859	N798K	probably benign	Het
Olfr1206	C	T	2: 88,864,830	T75I	probably benign	Het
Olfr1288	T	A	2: 111,479,563	W260R	probably damaging	Het
Olfr1458	T	A	19: 13,103,272	I11F	probably benign	Het
Olfr156	T	C	4: 43,820,563	D266G	probably benign	Het
Olfr168	G	A	16: 19,530,141	R260*	probably null	Het
Olfr353	T	G	2: 36,890,618	T77P	probably benign	Het
Olfr68	A	T	7: 103,777,475	L290Q	probably damaging	Het
Pcdh18	T	A	3: 49,756,441	I142F	probably damaging	Het
Pcyox1	T	C	6: 86,389,143	D363G	probably benign	Het
Pcyox1	T	C	6: 86,389,230	E334G	possibly damaging	Het
Pgm1	A	G	5: 64,105,947		probably null	Het
Plagl1	T	G	10: 13,127,999		probably benign	Het
Ppp1r9a	A	G	6: 4,906,537	D364G	possibly damaging	Het
Rab2b	T	A	14: 52,266,242	H141L	possibly damaging	Het
Rev3l	A	G	10: 39,828,416	K279E	probably benign	Het
Rnf111	G	T	9: 70,450,396	T607N	probably benign	Het
Scn8a	C	A	15: 101,016,503	S1130*	probably null	Het
Selenbp1	A	G	3: 94,944,568	*473W	probably null	Het
Skint5	T	A	4: 113,629,117		probably null	Het
Slc1a4	A	G	11: 20,308,452	L249P	probably damaging	Het
Slc45a2	T	A	15: 11,012,576	S222T	probably benign	Het
Slc7a4	A	G	16: 17,574,391	F393S	probably damaging	Het
Slc9a2	A	T	1: 40,761,918	D536V	possibly damaging	Het
Stra6	T	A	9: 58,140,832		probably benign	Het
Tmem145	A	G	7: 25,307,825	D156G	probably benign	Het
Tns3	A	C	11: 8,451,119	F1060V	probably benign	Het
Trak1	G	A	9: 121,454,425	R419Q	probably benign	Het
Trappc8	A	G	18: 20,867,808	S273P	probably benign	Het
Trmt11	A	G	10: 30,559,204	S320P	probably benign	Het
Ugt1a6a	A	T	1: 88,139,258	Y262F	probably benign	Het
Vmn1r73	G	A	7: 11,756,831	C192Y	probably benign	Het
Vmn2r103	T	C	17: 19,793,696	I250T	probably benign	Het
Vmn2r25	T	A	6: 123,853,003	D63V	possibly damaging	Het
Vps13b	C	T	15: 35,646,132	H1461Y	possibly damaging	Het
Ythdc2	A	T	18: 44,887,631	E1427D	probably benign	Het
Zbtb26	A	G	2: 37,436,956	F23L	probably benign	Het
Zfp62	T	A	11: 49,217,805	*908R	probably null	Het
Zfp975	A	T	7: 42,662,945	N81K	probably benign	Het
Zkscan16	G	A	4: 58,951,918	V198M	probably damaging	Het

Other mutations in Sh3bp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01062:Sh3bp4	APN	1	89143960	missense	probably benign
IGL01344:Sh3bp4	APN	1	89153236	missense	probably benign
IGL02025:Sh3bp4	APN	1	89145286	missense	probably benign	0.40
IGL02035:Sh3bp4	APN	1	89143690	missense	probably benign	0.00
IGL02389:Sh3bp4	APN	1	89145148	missense	probably damaging	0.99
IGL02430:Sh3bp4	APN	1	89153163	missense	probably null	0.00
IGL02546:Sh3bp4	APN	1	89143544	splice site	probably benign
IGL03327:Sh3bp4	APN	1	89144163	nonsense	probably null
I0000:Sh3bp4	UTSW	1	89137796	missense	probably benign	0.01
PIT4366001:Sh3bp4	UTSW	1	89145434	missense	probably benign
R0128:Sh3bp4	UTSW	1	89145314	missense	possibly damaging	0.54
R0130:Sh3bp4	UTSW	1	89145314	missense	possibly damaging	0.54
R1370:Sh3bp4	UTSW	1	89143772	missense	probably benign	0.43
R1500:Sh3bp4	UTSW	1	89145488	missense	probably damaging	1.00
R2269:Sh3bp4	UTSW	1	89145592	missense	possibly damaging	0.62
R3407:Sh3bp4	UTSW	1	89145047	missense	possibly damaging	0.86
R3408:Sh3bp4	UTSW	1	89145047	missense	possibly damaging	0.86
R3615:Sh3bp4	UTSW	1	89137705	missense	probably damaging	0.99
R3616:Sh3bp4	UTSW	1	89137705	missense	probably damaging	0.99
R3721:Sh3bp4	UTSW	1	89145328	missense	possibly damaging	0.93
R3983:Sh3bp4	UTSW	1	89145869	missense	probably benign	0.00
R5024:Sh3bp4	UTSW	1	89145595	missense	probably damaging	1.00
R5040:Sh3bp4	UTSW	1	89144240	missense	probably damaging	1.00
R5249:Sh3bp4	UTSW	1	89137734	missense	probably damaging	1.00
R5306:Sh3bp4	UTSW	1	89144275	missense	probably damaging	0.99
R5319:Sh3bp4	UTSW	1	89145350	missense	probably benign
R5908:Sh3bp4	UTSW	1	89145883	missense	probably damaging	0.99
R6296:Sh3bp4	UTSW	1	89145489	missense	probably damaging	1.00
R6572:Sh3bp4	UTSW	1	89144921	missense	possibly damaging	0.78
R6660:Sh3bp4	UTSW	1	89153166	missense	possibly damaging	0.62
R6900:Sh3bp4	UTSW	1	89145767	missense	probably benign	0.00
R7319:Sh3bp4	UTSW	1	89153102	splice site	probably null
R7320:Sh3bp4	UTSW	1	89145494	missense	probably damaging	1.00
R7393:Sh3bp4	UTSW	1	89144448	missense	possibly damaging	0.79
R7516:Sh3bp4	UTSW	1	89145646	missense	probably damaging	1.00
R8402:Sh3bp4	UTSW	1	89145315	missense	probably benign	0.00
R8899:Sh3bp4	UTSW	1	89145575	missense	probably benign	0.45
R8915:Sh3bp4	UTSW	1	89152342	missense	probably damaging	0.99
R8953:Sh3bp4	UTSW	1	89144437	missense	probably damaging	0.97
R9137:Sh3bp4	UTSW	1	89144925	nonsense	probably null
R9718:Sh3bp4	UTSW	1	89145750	missense	probably damaging	0.99
RF016:Sh3bp4	UTSW	1	89145022	missense	probably benign
Z1176:Sh3bp4	UTSW	1	89145728	missense	probably benign	0.43

Predicted Primers

PCR Primer
(F):5'- ATCTTTGATGAGCTCCCAGC -3'
(R):5'- AATCTGCTGTGTCTCCCCAG -3'

Sequencing Primer
(F):5'- TGAGCTCCCAGCCACCAATG -3'
(R):5'- CCTCTGGCACATGGATACTGATG -3'

Posted On

2015-10-08