Incidental Mutation 'R4631:Atf6'
ID 349165
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Name activating transcription factor 6
Synonyms Atf6alpha, 9130025P16Rik, ESTM49
MMRRC Submission 041896-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.183) question?
Stock # R4631 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 170532243-170695340 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 170574766 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect probably null
Transcript: ENSMUST00000027974
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180190
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,165,270 (GRCm39) L368Q probably damaging Het
Abcc2 C T 19: 43,803,146 (GRCm39) P661S possibly damaging Het
Adgre4 T G 17: 56,121,305 (GRCm39) M457R probably null Het
Ank C A 15: 27,467,176 (GRCm39) F29L probably benign Het
Arhgap20 T C 9: 51,751,653 (GRCm39) probably benign Het
Bhmt1b G A 18: 87,774,525 (GRCm39) R16H probably damaging Het
Bod1l A G 5: 41,975,078 (GRCm39) F2079L probably damaging Het
Cd163 T C 6: 124,306,045 (GRCm39) *1122Q probably null Het
Ces2g T C 8: 105,694,094 (GRCm39) probably null Het
Cntnap3 A G 13: 64,926,697 (GRCm39) Y558H probably benign Het
Ctsm T A 13: 61,685,510 (GRCm39) S301C probably null Het
Dlc1 A C 8: 37,404,712 (GRCm39) probably null Het
Dlg2 A T 7: 91,737,822 (GRCm39) I435F probably damaging Het
Dnah5 T C 15: 28,402,099 (GRCm39) V3420A probably damaging Het
Dnah5 T A 15: 28,420,140 (GRCm39) Y3813N probably damaging Het
Dnajc13 A G 9: 104,067,616 (GRCm39) M1181T probably damaging Het
Drc3 C A 11: 60,255,734 (GRCm39) T107N probably benign Het
Dydc2 T C 14: 40,771,286 (GRCm39) E131G probably benign Het
Eif5b T C 1: 38,080,828 (GRCm39) V723A probably damaging Het
Fndc9 C A 11: 46,128,675 (GRCm39) H65N possibly damaging Het
Fzd1 A T 5: 4,805,865 (GRCm39) Y572* probably null Het
Gps1 T A 11: 120,679,065 (GRCm39) probably null Het
Gvin3 A G 7: 106,198,730 (GRCm39) noncoding transcript Het
Kazn G A 4: 141,845,471 (GRCm39) probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kcnip1 T A 11: 33,942,821 (GRCm39) noncoding transcript Het
Kif19a A G 11: 114,675,673 (GRCm39) I382V possibly damaging Het
Krt1 C T 15: 101,754,622 (GRCm39) G543S unknown Het
Malsu1 A T 6: 49,061,467 (GRCm39) E177V probably damaging Het
Man2a2 A G 7: 80,012,211 (GRCm39) F649L probably benign Het
Map3k11 A G 19: 5,740,941 (GRCm39) I223V probably benign Het
Mroh2a A G 1: 88,186,386 (GRCm39) S64G probably benign Het
Myh9 T G 15: 77,681,228 (GRCm39) D164A probably damaging Het
Myo16 T C 8: 10,556,984 (GRCm39) I1040T probably damaging Het
Myo18b C T 5: 112,994,266 (GRCm39) A896T probably damaging Het
Myocd G T 11: 65,069,685 (GRCm39) N798K probably benign Het
Or13c7b T C 4: 43,820,563 (GRCm39) D266G probably benign Het
Or1n1b T G 2: 36,780,630 (GRCm39) T77P probably benign Het
Or2l13b G A 16: 19,348,891 (GRCm39) R260* probably null Het
Or4c11 C T 2: 88,695,174 (GRCm39) T75I probably benign Het
Or4g7 T A 2: 111,309,908 (GRCm39) W260R probably damaging Het
Or52a5 A T 7: 103,426,682 (GRCm39) L290Q probably damaging Het
Or5b105 T A 19: 13,080,636 (GRCm39) I11F probably benign Het
Pcdh18 T A 3: 49,710,890 (GRCm39) I142F probably damaging Het
Pcyox1 T C 6: 86,366,212 (GRCm39) E334G possibly damaging Het
Pcyox1 T C 6: 86,366,125 (GRCm39) D363G probably benign Het
Pgm2 A G 5: 64,263,290 (GRCm39) probably null Het
Plagl1 T G 10: 13,003,743 (GRCm39) probably benign Het
Ppp1r9a A G 6: 4,906,537 (GRCm39) D364G possibly damaging Het
Rab2b T A 14: 52,503,699 (GRCm39) H141L possibly damaging Het
Rev3l A G 10: 39,704,412 (GRCm39) K279E probably benign Het
Rnf111 G T 9: 70,357,678 (GRCm39) T607N probably benign Het
Scn8a C A 15: 100,914,384 (GRCm39) S1130* probably null Het
Selenbp1 A G 3: 94,851,879 (GRCm39) *473W probably null Het
Sh3bp4 A C 1: 89,071,995 (GRCm39) D281A probably damaging Het
Skint5 T A 4: 113,486,314 (GRCm39) probably null Het
Slc1a4 A G 11: 20,258,452 (GRCm39) L249P probably damaging Het
Slc45a2 T A 15: 11,012,662 (GRCm39) S222T probably benign Het
Slc7a4 A G 16: 17,392,255 (GRCm39) F393S probably damaging Het
Slc9a2 A T 1: 40,801,078 (GRCm39) D536V possibly damaging Het
Stra6 T A 9: 58,048,115 (GRCm39) probably benign Het
Tmem145 A G 7: 25,007,250 (GRCm39) D156G probably benign Het
Tns3 A C 11: 8,401,119 (GRCm39) F1060V probably benign Het
Trak1 G A 9: 121,283,491 (GRCm39) R419Q probably benign Het
Trappc8 A G 18: 21,000,865 (GRCm39) S273P probably benign Het
Trmt11 A G 10: 30,435,200 (GRCm39) S320P probably benign Het
Ugt1a6a A T 1: 88,066,980 (GRCm39) Y262F probably benign Het
Vmn1r73 G A 7: 11,490,758 (GRCm39) C192Y probably benign Het
Vmn2r103 T C 17: 20,013,958 (GRCm39) I250T probably benign Het
Vmn2r25 T A 6: 123,829,962 (GRCm39) D63V possibly damaging Het
Vps13b C T 15: 35,646,278 (GRCm39) H1461Y possibly damaging Het
Ythdc2 A T 18: 45,020,698 (GRCm39) E1427D probably benign Het
Zbed6 A T 1: 133,586,482 (GRCm39) V285E probably damaging Het
Zbtb26 A G 2: 37,326,968 (GRCm39) F23L probably benign Het
Zfp62 T A 11: 49,108,632 (GRCm39) *908R probably null Het
Zfp975 A T 7: 42,312,369 (GRCm39) N81K probably benign Het
Zkscan16 G A 4: 58,951,918 (GRCm39) V198M probably damaging Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170,616,175 (GRCm39) critical splice donor site probably null
IGL01431:Atf6 APN 1 170,680,571 (GRCm39) splice site probably benign
IGL01755:Atf6 APN 1 170,616,180 (GRCm39) missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170,646,989 (GRCm39) missense probably damaging 0.99
IGL02416:Atf6 APN 1 170,574,726 (GRCm39) nonsense probably null
IGL02903:Atf6 APN 1 170,627,283 (GRCm39) missense probably benign 0.00
IGL02989:Atf6 APN 1 170,616,252 (GRCm39) splice site probably benign
IGL03209:Atf6 APN 1 170,662,463 (GRCm39) missense probably benign
R0455:Atf6 UTSW 1 170,662,492 (GRCm39) missense probably benign 0.00
R0467:Atf6 UTSW 1 170,621,589 (GRCm39) missense probably damaging 1.00
R0491:Atf6 UTSW 1 170,614,913 (GRCm39) critical splice donor site probably null
R0784:Atf6 UTSW 1 170,537,516 (GRCm39) missense probably benign 0.19
R1486:Atf6 UTSW 1 170,622,260 (GRCm39) missense probably damaging 1.00
R1850:Atf6 UTSW 1 170,646,855 (GRCm39) missense probably damaging 1.00
R1945:Atf6 UTSW 1 170,682,710 (GRCm39) missense probably benign 0.00
R2164:Atf6 UTSW 1 170,622,304 (GRCm39) missense probably damaging 1.00
R3782:Atf6 UTSW 1 170,622,336 (GRCm39) nonsense probably null
R4454:Atf6 UTSW 1 170,621,608 (GRCm39) missense probably damaging 0.99
R4676:Atf6 UTSW 1 170,614,979 (GRCm39) missense probably damaging 1.00
R5772:Atf6 UTSW 1 170,574,758 (GRCm39) missense probably damaging 1.00
R5860:Atf6 UTSW 1 170,669,345 (GRCm39) missense possibly damaging 0.95
R5860:Atf6 UTSW 1 170,669,344 (GRCm39) missense probably damaging 1.00
R5950:Atf6 UTSW 1 170,662,448 (GRCm39) missense probably damaging 1.00
R6242:Atf6 UTSW 1 170,621,545 (GRCm39) missense possibly damaging 0.46
R6520:Atf6 UTSW 1 170,695,238 (GRCm39) missense probably benign 0.00
R7032:Atf6 UTSW 1 170,627,181 (GRCm39) critical splice donor site probably null
R7472:Atf6 UTSW 1 170,643,060 (GRCm39) missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170,622,275 (GRCm39) missense probably benign
R8002:Atf6 UTSW 1 170,646,823 (GRCm39) missense probably benign 0.43
R8860:Atf6 UTSW 1 170,680,535 (GRCm39) missense probably null 0.95
R8956:Atf6 UTSW 1 170,621,576 (GRCm39) missense probably damaging 0.98
R9090:Atf6 UTSW 1 170,622,245 (GRCm39) missense probably damaging 1.00
R9271:Atf6 UTSW 1 170,622,245 (GRCm39) missense probably damaging 1.00
R9323:Atf6 UTSW 1 170,682,682 (GRCm39) nonsense probably null
R9500:Atf6 UTSW 1 170,574,708 (GRCm39) missense probably damaging 0.98
R9594:Atf6 UTSW 1 170,668,402 (GRCm39) missense probably benign 0.18
R9733:Atf6 UTSW 1 170,662,402 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAGTGACTGTCTTGAATGCCC -3'
(R):5'- AATCTCGGAGTATTAGAAAACTGCC -3'

Sequencing Primer
(F):5'- TTGAATGCCCTCTCATTAACCAAGAG -3'
(R):5'- AAACTGCCACAGTGTGTCTG -3'
Posted On 2015-10-08