Incidental Mutation 'R4631:Ppp1r9a'
ID349182
Institutional Source Beutler Lab
Gene Symbol Ppp1r9a
Ensembl Gene ENSMUSG00000032827
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 9A
SynonymsA230094E16Rik, Neurabin I, 2810430P21Rik, neurabin-I, NRB, 4930518N04Rik
MMRRC Submission 041896-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R4631 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location4902917-5165661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4906537 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 364 (D364G)
Ref Sequence ENSEMBL: ENSMUSP00000135360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035813] [ENSMUST00000168998] [ENSMUST00000175889] [ENSMUST00000175962] [ENSMUST00000176263] [ENSMUST00000176729] [ENSMUST00000177153] [ENSMUST00000177338] [ENSMUST00000177456]
Predicted Effect probably benign
Transcript: ENSMUST00000035813
AA Change: D364G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827
AA Change: D364G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 5e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1052 6.41e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164110
Predicted Effect probably benign
Transcript: ENSMUST00000168998
AA Change: D364G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126643
Gene: ENSMUSG00000032827
AA Change: D364G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175889
AA Change: D364G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000135629
Gene: ENSMUSG00000032827
AA Change: D364G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1041 1.72e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000175962
AA Change: D364G

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135360
Gene: ENSMUSG00000032827
AA Change: D364G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDB:3HVQ|D 436 466 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176263
AA Change: D364G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134937
Gene: ENSMUSG00000032827
AA Change: D364G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
low complexity region 643 649 N/A INTRINSIC
Blast:PDZ 763 800 2e-15 BLAST
low complexity region 806 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176729
AA Change: D44G

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134909
Gene: ENSMUSG00000032827
AA Change: D44G

DomainStartEndE-ValueType
low complexity region 96 115 N/A INTRINSIC
PDB:3HVQ|D 116 232 4e-79 PDB
SCOP:d1be9a_ 174 232 5e-9 SMART
Blast:PDZ 193 232 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177153
AA Change: D364G

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135485
Gene: ENSMUSG00000032827
AA Change: D364G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177338
AA Change: D364G

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135634
Gene: ENSMUSG00000032827
AA Change: D364G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177456
AA Change: D364G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134943
Gene: ENSMUSG00000032827
AA Change: D364G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1040 1049 N/A INTRINSIC
low complexity region 1103 1114 N/A INTRINSIC
SAM 1183 1249 6.41e-16 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in dopamine-mediated neuromodulation, deficient long-term potentiation at corticostriatal synapses, increased spontaneous excitatory post-synaptic current frequency, and enhanced locomotor activationin response to cocaine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,257,987 L368Q probably damaging Het
Abcc2 C T 19: 43,814,707 P661S possibly damaging Het
Adgre4 T G 17: 55,814,305 M457R probably null Het
Ank C A 15: 27,467,090 F29L probably benign Het
Arhgap20 T C 9: 51,840,353 probably benign Het
Atf6 T C 1: 170,747,197 probably null Het
Bod1l A G 5: 41,817,735 F2079L probably damaging Het
Cd163 T C 6: 124,329,086 *1122Q probably null Het
Ces2g T C 8: 104,967,462 probably null Het
Cntnap3 A G 13: 64,778,883 Y558H probably benign Het
Ctsm T A 13: 61,537,696 S301C probably null Het
Dlc1 A C 8: 36,937,558 probably null Het
Dlg2 A T 7: 92,088,614 I435F probably damaging Het
Dnah5 T C 15: 28,401,953 V3420A probably damaging Het
Dnah5 T A 15: 28,419,994 Y3813N probably damaging Het
Dnajc13 A G 9: 104,190,417 M1181T probably damaging Het
Drc3 C A 11: 60,364,908 T107N probably benign Het
Dydc2 T C 14: 41,049,329 E131G probably benign Het
Eif5b T C 1: 38,041,747 V723A probably damaging Het
Fndc9 C A 11: 46,237,848 H65N possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Gm1966 A G 7: 106,599,523 noncoding transcript Het
Gm38394 A T 1: 133,658,744 V285E probably damaging Het
Gm5096 G A 18: 87,756,401 R16H probably damaging Het
Gps1 T A 11: 120,788,239 probably null Het
Kazn G A 4: 142,118,160 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnip1 T A 11: 33,992,821 noncoding transcript Het
Kif19a A G 11: 114,784,847 I382V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Malsu1 A T 6: 49,084,533 E177V probably damaging Het
Man2a2 A G 7: 80,362,463 F649L probably benign Het
Map3k11 A G 19: 5,690,913 I223V probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh9 T G 15: 77,797,028 D164A probably damaging Het
Myo16 T C 8: 10,506,984 I1040T probably damaging Het
Myo18b C T 5: 112,846,400 A896T probably damaging Het
Myocd G T 11: 65,178,859 N798K probably benign Het
Olfr1206 C T 2: 88,864,830 T75I probably benign Het
Olfr1288 T A 2: 111,479,563 W260R probably damaging Het
Olfr1458 T A 19: 13,103,272 I11F probably benign Het
Olfr156 T C 4: 43,820,563 D266G probably benign Het
Olfr168 G A 16: 19,530,141 R260* probably null Het
Olfr353 T G 2: 36,890,618 T77P probably benign Het
Olfr68 A T 7: 103,777,475 L290Q probably damaging Het
Pcdh18 T A 3: 49,756,441 I142F probably damaging Het
Pcyox1 T C 6: 86,389,143 D363G probably benign Het
Pcyox1 T C 6: 86,389,230 E334G possibly damaging Het
Pgm1 A G 5: 64,105,947 probably null Het
Plagl1 T G 10: 13,127,999 probably benign Het
Rab2b T A 14: 52,266,242 H141L possibly damaging Het
Rev3l A G 10: 39,828,416 K279E probably benign Het
Rnf111 G T 9: 70,450,396 T607N probably benign Het
Scn8a C A 15: 101,016,503 S1130* probably null Het
Selenbp1 A G 3: 94,944,568 *473W probably null Het
Sh3bp4 A C 1: 89,144,273 D281A probably damaging Het
Skint5 T A 4: 113,629,117 probably null Het
Slc1a4 A G 11: 20,308,452 L249P probably damaging Het
Slc45a2 T A 15: 11,012,576 S222T probably benign Het
Slc7a4 A G 16: 17,574,391 F393S probably damaging Het
Slc9a2 A T 1: 40,761,918 D536V possibly damaging Het
Stra6 T A 9: 58,140,832 probably benign Het
Tmem145 A G 7: 25,307,825 D156G probably benign Het
Tns3 A C 11: 8,451,119 F1060V probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Trappc8 A G 18: 20,867,808 S273P probably benign Het
Trmt11 A G 10: 30,559,204 S320P probably benign Het
Ugt1a6a A T 1: 88,139,258 Y262F probably benign Het
Vmn1r73 G A 7: 11,756,831 C192Y probably benign Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Vmn2r25 T A 6: 123,853,003 D63V possibly damaging Het
Vps13b C T 15: 35,646,132 H1461Y possibly damaging Het
Ythdc2 A T 18: 44,887,631 E1427D probably benign Het
Zbtb26 A G 2: 37,436,956 F23L probably benign Het
Zfp62 T A 11: 49,217,805 *908R probably null Het
Zfp975 A T 7: 42,662,945 N81K probably benign Het
Zkscan16 G A 4: 58,951,918 V198M probably damaging Het
Other mutations in Ppp1r9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ppp1r9a APN 6 5158195 missense possibly damaging 0.72
IGL00796:Ppp1r9a APN 6 5157014 missense probably benign 0.37
IGL00906:Ppp1r9a APN 6 5157023 missense possibly damaging 0.62
IGL01662:Ppp1r9a APN 6 5115322 missense probably damaging 1.00
IGL01695:Ppp1r9a APN 6 5064003 missense probably damaging 1.00
IGL01807:Ppp1r9a APN 6 5158248 nonsense probably null
IGL02126:Ppp1r9a APN 6 5156229 missense probably damaging 1.00
IGL02423:Ppp1r9a APN 6 4906537 missense probably benign 0.25
IGL03343:Ppp1r9a APN 6 5046015 missense probably damaging 1.00
IGL03365:Ppp1r9a APN 6 5110993 splice site probably benign
R0545:Ppp1r9a UTSW 6 5115357 missense probably benign 0.45
R1126:Ppp1r9a UTSW 6 4906795 missense possibly damaging 0.93
R1137:Ppp1r9a UTSW 6 5159697 missense possibly damaging 0.46
R1443:Ppp1r9a UTSW 6 5057557 missense probably damaging 1.00
R1484:Ppp1r9a UTSW 6 5113712 nonsense probably null
R1545:Ppp1r9a UTSW 6 5156242 critical splice donor site probably null
R1627:Ppp1r9a UTSW 6 4906168 missense possibly damaging 0.50
R1672:Ppp1r9a UTSW 6 5143491 critical splice donor site probably null
R1826:Ppp1r9a UTSW 6 5111060 splice site probably benign
R1834:Ppp1r9a UTSW 6 5113710 missense probably damaging 0.98
R1874:Ppp1r9a UTSW 6 4906348 missense possibly damaging 0.87
R2224:Ppp1r9a UTSW 6 5154074 missense probably benign
R2227:Ppp1r9a UTSW 6 5154074 missense probably benign
R2898:Ppp1r9a UTSW 6 4906558 missense probably benign 0.01
R3606:Ppp1r9a UTSW 6 5113674 missense possibly damaging 0.90
R3732:Ppp1r9a UTSW 6 4906259 unclassified probably benign
R3927:Ppp1r9a UTSW 6 5057531 missense probably damaging 1.00
R4682:Ppp1r9a UTSW 6 4905477 missense possibly damaging 0.48
R4766:Ppp1r9a UTSW 6 5157016 missense probably benign 0.11
R5197:Ppp1r9a UTSW 6 5156177 missense probably damaging 1.00
R5217:Ppp1r9a UTSW 6 5115367 missense probably damaging 1.00
R5493:Ppp1r9a UTSW 6 5159702 missense probably damaging 0.99
R5790:Ppp1r9a UTSW 6 5134363 intron probably benign
R5828:Ppp1r9a UTSW 6 5158200 missense probably damaging 1.00
R5896:Ppp1r9a UTSW 6 5159648 missense probably damaging 1.00
R5930:Ppp1r9a UTSW 6 5157002 critical splice acceptor site probably null
R5990:Ppp1r9a UTSW 6 5134660 missense probably benign 0.05
R6017:Ppp1r9a UTSW 6 4906363 missense probably benign 0.18
R6122:Ppp1r9a UTSW 6 4905509 missense probably damaging 1.00
R6164:Ppp1r9a UTSW 6 5110715 intron probably benign
R6175:Ppp1r9a UTSW 6 4905639 nonsense probably null
R6188:Ppp1r9a UTSW 6 5158113 nonsense probably null
R6233:Ppp1r9a UTSW 6 5077610 missense probably damaging 1.00
R6321:Ppp1r9a UTSW 6 5115151 missense probably damaging 1.00
R6449:Ppp1r9a UTSW 6 5057458 missense probably benign 0.44
R6454:Ppp1r9a UTSW 6 4905827 missense probably damaging 1.00
R6527:Ppp1r9a UTSW 6 5045949 missense probably damaging 1.00
R7053:Ppp1r9a UTSW 6 4905670 missense probably damaging 1.00
R7233:Ppp1r9a UTSW 6 5134804 missense probably benign
R7238:Ppp1r9a UTSW 6 5159716 missense probably damaging 1.00
R7438:Ppp1r9a UTSW 6 5115378 missense probably damaging 0.99
R7497:Ppp1r9a UTSW 6 4905775 missense probably damaging 1.00
R7666:Ppp1r9a UTSW 6 5143238 missense probably benign 0.00
R7698:Ppp1r9a UTSW 6 4906430 missense probably benign
RF007:Ppp1r9a UTSW 6 4906657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTAGTGAAGAGAGCCAG -3'
(R):5'- TCCGGCAAGCCAACTATCTC -3'

Sequencing Primer
(F):5'- GCCGAGGACGTCACAACAG -3'
(R):5'- CCGAGTATTCCATATCAGGCTGG -3'
Posted On2015-10-08